Clone Read LE_HBa0113O19_T7_37957

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0113O19_T7_37957
Primer
T7
ID from Seq. Facility
LE_HBa_113_O19-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
661 trimmed for vector and quality, 770 raw
Genbank Accession
Sequence
>LE_HBa0113O19_T7_37957 (raw untrimmed)
CCTGGGCCCCGCGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAGTCAAAAATATCTGCCAGTCCACAAATCCTACAGGTGCGGCGAAACGTGC
CAACCTCTTTGGACGGTTATCAATCTTGTTTCCTTGGCCAAGATATGTATCTACCACGTCAGATCACTCGTGGAAGTGATCGATAGCCCATAGTTGAAGT
AGAAGGTTGCATCCTTTGAAGAACATTCTACCATCAACACATACTGGCAGACTCCTCATTATCTCCGCTAGAATCATGGGCACTATGGTTTTCCTAGGAT
CGCCCCCTCTTTGAGCTAGGTATCAAACCACGTACCTTAGACATGTATCGGTTCTTCCCCTTGACTTAGGAAAAACCAAGGATCCCAATAAGGCGATGGC
AAAGGCATGCAGACGATACTCTTCCCATTCTTCAACGGAGCACTCAAATTCATAGCCATAAATGTAGTAGCCATCATCTCGGACGAATCGTGAGTATTAG
AAGTCTAAATGCGTCCACCCAAGGTCTAAAGAAGTCCAGGTTGGATTAGACTTCATCCCCATACTTTTTATAAATTCTCTTGATGACGACTTATAAGGTA
TCATCATTTGGCACTCATGGTATGGAAGGTCGATGAAACCGCTAATTTCTTCTATTGTTGCCGCCCAGTTGCAATCTATAAACTTGAACACCCATCCTCA
CAGGGTCCCAAAACTCTAAGTACCCCCCTAGTCTGGTTTGGGTTTGGTGTGACGAATATAAGAAATATGA
>LE_HBa0113O19_T7_37957 (trimmed for quality and cloning vector)
AGCTTAGTCAAAAATATCTGCCAGTCCACAAATCCTACAGGTGCGGCGAAACGTGCCAACCTCTTTGGACGGTTATCAATCTTGTTTCCTTGGCCAAGAT
ATGTATCTACCACGTCAGATCACTCGTGGAAGTGATCGATAGCCCATAGTTGAAGTAGAAGGTTGCATCCTTTGAAGAACATTCTACCATCAACACATAC
TGGCAGACTCCTCATTATCTCCGCTAGAATCATGGGCACTATGGTTTTCCTAGGATCGCCCCCTCTTTGAGCTAGGTATCAAACCACGTACCTTAGACAT
GTATCGGTTCTTCCCCTTGACTTAGGAAAAACCAAGGATCCCAATAAGGCGATGGCAAAGGCATGCAGACGATACTCTTCCCATTCTTCAACGGAGCACT
CAAATTCATAGCCATAAATGTAGTAGCCATCATCTCGGACGAATCGTGAGTATTAGAAGTCTAAATGCGTCCACCCAAGGTCTAAAGAAGTCCAGGTTGG
ATTAGACTTCATCCCCATACTTTTTATAAATTCTCTTGATGACGACTTATAAGGTATCATCATTTGGCACTCATGGTATGGAAGGTCGATGAAACCGCTA
ATTTCTTCTATTGTTGCCGCCCAGTTGCAATCTATAAACTTGAACACCCATCCTCACAGGG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.986511
Expected error %
0.558767
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT39965.1| Score 126 E Value 4e-28 Identity 12.10% Align. Length 638bp (96.52%) Frame 1
hypothetical protein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAC53932.1| Score 99 E Value 9e-20 Identity 10.00% Align. Length 626bp (94.70%) Frame 1
hypothetical protein [Nicotiana tabacum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0113O19
Clone
Clone name
hba-113o19
LE_HBa0113O19
P113O19
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found