Clone Read LE_HBa0244N11_SP6_379651

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0244N11_SP6_379651
Primer
SP6
ID from Seq. Facility
LE_HBa_244_N11-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
519 trimmed for vector and quality, 901 raw
Sequence
>LE_HBa0244N11_SP6_379651 (raw untrimmed)
NNNCCGATANGTACATTCCGCCTGTTGTGTAACCGCTTCACAACCAATCGTGCCTTGAACCTTTCTCTTTTCAGATATGCTTTGTGTTTTACTTTGTATA
CCCACCTCCTTCCAAGTGCTTATTTGTTTGGTGGTAAAGTAACAAGATCCCAAGTGTCATTATCATACAGTGCTTCAAACTCTTGTATCATGGCCTTTTG
CCATGCAAGATTCAGTGATGCTTCCTCATATGATGATGGCTCACTATCATGACAAATGTTCTCAACAAGTGACTGACTAGTAGATGCAATGACTTCAGGA
GATATATGGTGGTGTTTGGTAAACAATGCAGTAAGGGATAGATTATTGTTGATCTCTGTGTTTTGTGTGTTGGAATTGACTGATTTTAGTTTTGGGATAT
TGATAACATAATCTTTCAAATGTGATGGTATTTTGTTTTCTCTATGAGATCTTCTCTGTACTATTGTGGGAGGATTGTGTTGGGATGATGTTGAAGAGGT
AATGGGAGCACTGGAAGATATACTGGGATTTTGACTAATGTGAGAAGATATATGAGGAGGAGTTGTATCAGTCACATTGTCACAATCAATTACACAGCCT
TTATATGAATCTAAATCAGCATAATCAGATGATGAAAAAGATTTTTAAACATAATGAAAAAAAGGATTTTCTGTTTTACAAACCTAAAAGAAAAATATGT
TCCTGGAAAAACACATCCCTTGAGAAAAGTAATTTCTTTGTGCACATACTCATCACATTTAAAACTTTGGTTCTAAAAAAATTTCTAAAAATAACGTTTT
GGGTGAAATTAAGTTTTTAATTTTTCTAATTAACTTTCCATAGTTAGTGTAACATAATTAACAATAAATCTATGGTAAATATTAACTTTGTACTTATGTA
A
>LE_HBa0244N11_SP6_379651 (trimmed for quality and cloning vector)
ACCGCTTCACAACCAATCGTGCCTTGAACCTTTCTCTTTTCAGATATGCTTTGTGTTTTACTTTGTATACCCACCTCCTTCCAAGTGCTTATTTGTTTGG
TGGTAAAGTAACAAGATCCCAAGTGTCATTATCATACAGTGCTTCAAACTCTTGTATCATGGCCTTTTGCCATGCAAGATTCAGTGATGCTTCCTCATAT
GATGATGGCTCACTATCATGACAAATGTTCTCAACAAGTGACTGACTAGTAGATGCAATGACTTCAGGAGATATATGGTGGTGTTTGGTAAACAATGCAG
TAAGGGATAGATTATTGTTGATCTCTGTGTTTTGTGTGTTGGAATTGACTGATTTTAGTTTTGGGATATTGATAACATAATCTTTCAAATGTGATGGTAT
TTTGTTTTCTCTATGAGATCTTCTCTGTACTATTGTGGGAGGATTGTGTTGGGATGATGTTGAAGAGGTAATGGGAGCACTGGAAGATATACTGGGATTT
TGACTAATGTGAGAAGATA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.950599
Expected error %
0.526956
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0244N11
Clone
Clone name
hba-244n11
LE_HBa0244N11
P244N11
Clone type
BAC
Contamination
none
Estimated length
115,252
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found