Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Clone Read LE_HBa0244N19_SP6_379681

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0244N19_SP6_379681
Primer
SP6
ID from Seq. Facility
LE_HBa_244_N19-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
80 trimmed for vector and quality, 897 raw
Sequence
>LE_HBa0244N19_SP6_379681 (raw untrimmed)
NCGAATGCATGGCTAAAACTGATTTGATGCCTGCTTATTCTCTGGATCAATATCCCAGCTTCAATAAAGGTAAAGTCATTTTCATCTTGTGGGGTGGGGG
GCTTAAGAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNCTCTCAAAANNNNNNNNNNNNNANNNNA
NNNANAAANAAAGGAAAGAAAAAAAAAANAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAANAAAAAAAAAAAAAAAAAAAAANAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAANAATTTT
TTTTTTATAAAAAAAATTTAAAATTTTATTTTTTGGTGAGATAAAAAAATAATATTTTTTTTTTTTATTTATTAATAATTTTTTTTATATTATTTTTAAA
ATAAAAAATTAATTTTTTATATATTAATATTANTAATATAATTAATTATTATTTTTTAAAATTTTTTATATAATATTATAATTTAATTTTATTATTATTT
TTTATAATTATTTTTAAAATTTTATATATATTTTTTTAATTATATAATATAAATTTATTATTATAATATTTATAATATAATTATTTAATAAATTATATTA
TTAAATATAATAATTTATTTATAAATATATAATATTATATTTATATTTTTTTTATTATATATATATTAATTTTTTATATTAAATATAATTATTTTATCTA
CTTAATTATTTTATTTTATTGAATAAAATAATATTTTTTATTTTATTTATATTTTTAANTAAAATTATTTATTTAATTTTTATATTAATTTTATTAT
>LE_HBa0244N19_SP6_379681 (trimmed for quality and cloning vector)
TGATTTGATGCCTGCTTATTCTCTGGATCAATATCCCAGCTTCAATAAAGGTAAAGTCATTTTCATCTTGTGGGGTGGGG

This is probably not a useful sequence.

Problems:
  • Short cloning insert
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.892882
Expected error %
2.1097
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0244N19
Clone
Clone name
hba-244n19
LE_HBa0244N19
P244N19
Clone type
BAC
Contamination
none
Estimated length
109,310
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found