Clone Read LE_HBa0244N19_T7_379684

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0244N19_T7_379684
Primer
T7
ID from Seq. Facility
LE_HBa_244_N19-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
626 trimmed for vector and quality, 857 raw
Sequence
>LE_HBa0244N19_T7_379684 (raw untrimmed)
CACCGTCGGGGATCTCTGAGTCGACCTGCAGGCATGCAGCTTATCAAAGAAAGCATGTAATGATCATTTACAATGTGACATGTTTATAACAATTTCTTAA
TGTTTGCATTATAAGAAACAATATTTGAACGTCACGATATATTATAAAGTTAATACATTTTATGAGATTACCCTGGTGTAGAAAATGGTATGCAAATGAT
TTTATTCATAATCAATGTAGAAAATAGTATGTTTATATGTATTAGTACATATTTTTATAAATGTTAAATAAATTAGTATAAATTCTATATATGGAAGTGA
AGTTCCAAAACACCAGATTTTACACTAATATATAATTTGGTGTTGGATTAGAGATGGTCTAAGTACAATAGAATCGTAAAAGTTGTTAAACAGAACTCCT
TGCATGTATTATAAAAACCTTACAATGTGGATATTTTGGATGAATTTATTCTACTCCAAAGACTTGACATTTTCGAAATCACTTTTGACGACCCTTAAAA
TCATATTTCACTAGTATTAGTGTTTACTATTTTGAACACTTTTTTACAAATTATTCTCCGTTAATGTTTTGAGTAAAGTTTCACCATGTGTTTGACTGTA
CATCTTGAAAGAAAAAATTCAATCATTCAAAAAAATGTGATTTATACCTATAAACTCTAAAAACTATTCAAAAATATCTATAAATTTGCATTGTCATTTG
ATATTCAATGTGTCTTGTGAAAAGTCATTATACCGAACACAATAAATATCATTGATTTGTACAAAAAAAATGCCATTACTATTTGTCGTTGAAATTCACT
CTGGGAAAATTTGTACAATAATCCTAGGAATGGACATTTCAATCCAAAAATTTTAAG
>LE_HBa0244N19_T7_379684 (trimmed for quality and cloning vector)
CTGCAGGCATGCAGCTTATCAAAGAAAGCATGTAATGATCATTTACAATGTGACATGTTTATAACAATTTCTTAATGTTTGCATTATAAGAAACAATATT
TGAACGTCACGATATATTATAAAGTTAATACATTTTATGAGATTACCCTGGTGTAGAAAATGGTATGCAAATGATTTTATTCATAATCAATGTAGAAAAT
AGTATGTTTATATGTATTAGTACATATTTTTATAAATGTTAAATAAATTAGTATAAATTCTATATATGGAAGTGAAGTTCCAAAACACCAGATTTTACAC
TAATATATAATTTGGTGTTGGATTAGAGATGGTCTAAGTACAATAGAATCGTAAAAGTTGTTAAACAGAACTCCTTGCATGTATTATAAAAACCTTACAA
TGTGGATATTTTGGATGAATTTATTCTACTCCAAAGACTTGACATTTTCGAAATCACTTTTGACGACCCTTAAAATCATATTTCACTAGTATTAGTGTTT
ACTATTTTGAACACTTTTTTACAAATTATTCTCCGTTAATGTTTTGAGTAAAGTTTCACCATGTGTTTGACTGTACATCTTGAAAGAAAAAATTCAATCA
TTCAAAAAAATGTGATTTATACCTAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.907763
Expected error %
0.663679
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0244N19
Clone
Clone name
hba-244n19
LE_HBa0244N19
P244N19
Clone type
BAC
Contamination
none
Estimated length
109,310
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found