Clone Read LE_HBa0244O02_SP6_379708

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0244O02_SP6_379708
Primer
SP6
ID from Seq. Facility
LE_HBa_244_O02-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
711 trimmed for vector and quality, 842 raw
Sequence
>LE_HBa0244O02_SP6_379708 (raw untrimmed)
CTAGATTAATTTAACGTATTAAATATTGAGTTATAAATTAATAATTTATAATTATTAAATATCTTTAAAAAGGATAAATATAATATCTAAATCAAAATGT
CGACTTCATAAACAAAATTGTAAACTTGTTGGGTTTTTCTCTTTTGGTACCTCAACTAAATCATTTTTCAGCTGAATCATTGAACCACTCATAATTTGTT
CCTTTTAAATACCGTTGACTTATTTTGATAGTTTTTTTTTCATTGCAAATGTCTTCAATTGTGTTCGTATTATAATGATTTTGATTGAAGAAATGAAGAC
AATTAGTCTCGTTTATTTTCTATATATGTTCAAATGACTTGAAGTAAAACACAATTATTGTCAAACGGTTTCACTATCAATTGGAATAATGGGTTCTGAA
ACAATATATCTATTCTCTATCAATACTCCTCACAAAATTTGGTTCTACATCAACCAACGATGTTTAAAAAGAATAAATTATGGGTGGTTCAATAATTTAA
CAGGAAAATAATATAGTTGACGTACCTAAAGGGAAAAGCTGAACAAGTTAAAAATTTATTTATGTATTTGATCAAATCAAAATTACTAAATTCAATCAAA
CATATTAAACTCACTATTATTCTCCTAAATTTAGATAGTTATAACTCATGAACTACATGTTGGAATAATACAATTGATAATAGTTCTGATAAAATAATAT
GAATTTATAAGTTTCATTTCATTTAGTTAATACATTTTAAATTCGTTTGATAAATACGTTTATCTTATAAATTTTTAAAACCTATTAGTAATTGTTATTT
GATTAACACACATATGTTTAAAGAACATTTTATCCCAAAATA
>LE_HBa0244O02_SP6_379708 (trimmed for quality and cloning vector)
TAATTTAACGTATTAAATATTGAGTTATAAATTAATAATTTATAATTATTAAATATCTTTAAAAAGGATAAATATAATATCTAAATCAAAATGTCGACTT
CATAAACAAAATTGTAAACTTGTTGGGTTTTTCTCTTTTGGTACCTCAACTAAATCATTTTTCAGCTGAATCATTGAACCACTCATAATTTGTTCCTTTT
AAATACCGTTGACTTATTTTGATAGTTTTTTTTTCATTGCAAATGTCTTCAATTGTGTTCGTATTATAATGATTTTGATTGAAGAAATGAAGACAATTAG
TCTCGTTTATTTTCTATATATGTTCAAATGACTTGAAGTAAAACACAATTATTGTCAAACGGTTTCACTATCAATTGGAATAATGGGTTCTGAAACAATA
TATCTATTCTCTATCAATACTCCTCACAAAATTTGGTTCTACATCAACCAACGATGTTTAAAAAGAATAAATTATGGGTGGTTCAATAATTTAACAGGAA
AATAATATAGTTGACGTACCTAAAGGGAAAAGCTGAACAAGTTAAAAATTTATTTATGTATTTGATCAAATCAAAATTACTAAATTCAATCAAACATATT
AAACTCACTATTATTCTCCTAAATTTAGATAGTTATAACTCATGAACTACATGTTGGAATAATACAATTGATAATAGTTCTGATAAAATAATATGAATTT
ATAAGTTTCAT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.890627
Expected error %
0.214838
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0244O02
Clone
Clone name
hba-244o2
LE_HBa0244O02
P244O02
Clone type
BAC
Contamination
none
Estimated length
60,389
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found