Clone Read LE_HBa0244O09_SP6_379734

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0244O09_SP6_379734
Primer
SP6
ID from Seq. Facility
LE_HBa_244_O09-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
615 trimmed for vector and quality, 891 raw
Sequence
>LE_HBa0244O09_SP6_379734 (raw untrimmed)
NTTTGTACAAAGAAGTCTCCAGGGGAGGAGGTGTCTCCGATATCGGGGCATATTATGTGTGTCAACTTTGAGGGTTTGAGGCCTATTATTATTGCAGATG
ATTATCCTTCAAGGGATTCTATTCATCCAGGTTCTACAAAAATGTATCATGATCTCAAGGTGGTCTATTGATGGGAAGGTATCAAGAGAGATATCTCTAA
GTTTGTAGAGGAGTTTCCCAATCTTAAACAGGTTAAGAAAGAACACCTTTAGACTGGGGTATTACCCAGTCTATTGACATCCCAACATGGAAATGAAAGG
CTATTAATATGGATTTTATGGTTTGTCTACCTAGGACCAGAAAACTACATATTCTATTTGGGTTGCTATTAACAGAATGACTAAGTCTTCACACTCCATA
CTTGTGAAATCTACTTACAGGGCCAACTATTATGTCAGTTGTATATTAACGAGAAAGTGAGGTGGCATGGGATCCCTATATCTATAACTTGTGATAGGGT
ATCCCAGTTTAATTCTCATTTTTGGAGATCTTTCAAAAAGAGCTTAGGTACATAGGTAAAGCTCGATACTAGTTTTCATCCCCATACTGATGGAAAAGCA
GAGCGTACTATCCCAACCCCTTGAGACATACTGAGAGCATATGTTATTAACTTCAAGGGGAGTTGGGATGATCACTTGCCCCTGATTGGGTTCCTCCATT
AAAATAGCTATCACCCTAGCATAAGTATGGAACCTTTTTTGTGCACCTTAATGAAAGGAAGAATTTGGTCCCCAATTGTTTTCTGTCTTAAATAAAGGAA
ATTCCTACTATCCCTTGTCTCCCAAAGATTTTTTTAGTGTAAAATTTTGGTAAATAGTGTAGAAACGACTTAGGGGAATTTTTTTTTTTTN
>LE_HBa0244O09_SP6_379734 (trimmed for quality and cloning vector)
CTCCGATATCGGGGCATATTATGTGTGTCAACTTTGAGGGTTTGAGGCCTATTATTATTGCAGATGATTATCCTTCAAGGGATTCTATTCATCCAGGTTC
TACAAAAATGTATCATGATCTCAAGGTGGTCTATTGATGGGAAGGTATCAAGAGAGATATCTCTAAGTTTGTAGAGGAGTTTCCCAATCTTAAACAGGTT
AAGAAAGAACACCTTTAGACTGGGGTATTACCCAGTCTATTGACATCCCAACATGGAAATGAAAGGCTATTAATATGGATTTTATGGTTTGTCTACCTAG
GACCAGAAAACTACATATTCTATTTGGGTTGCTATTAACAGAATGACTAAGTCTTCACACTCCATACTTGTGAAATCTACTTACAGGGCCAACTATTATG
TCAGTTGTATATTAACGAGAAAGTGAGGTGGCATGGGATCCCTATATCTATAACTTGTGATAGGGTATCCCAGTTTAATTCTCATTTTTGGAGATCTTTC
AAAAAGAGCTTAGGTACATAGGTAAAGCTCGATACTAGTTTTCATCCCCATACTGATGGAAAAGCAGAGCGTACTATCCCAACCCCTTGAGACATACTGA
GAGCATATGTTATTA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.956524
Expected error %
0.874487
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0244O09
Clone
Clone name
hba-244o9
LE_HBa0244O09
C03HBa0244O09
P244O09
Clone type
BAC
Contamination
none
Estimated length
92,888
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found