Clone Read LE_HBa0245C22_T7_380175

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0245C22_T7_380175
Primer
T7
ID from Seq. Facility
LE_HBa_245_C22-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
587 trimmed for vector and quality, 863 raw
Sequence
>LE_HBa0245C22_T7_380175 (raw untrimmed)
GGGCTCTCTGAGTCGACCTGCAGGCATGCAAGCTTTGGGAAAATTCTTGCTTGATTCCTTCTTCGGTGGAGGTAGGTTATGGTTTTCATGCTATTCGTCC
TAAACTCTTAATAGTGAATGATATGTGTTAGTAGTATTGATAAACCCTTCTATATGCTTAGATTGTATGCTTGCATGAATGATGTGATTATGTAATTATG
AATACAATAAGCATGATGAAGCTATTGAATCCCAAATCTTAAAAAGAAACCCTAATCTACTTTGTTAATGATGATCCCTTGGTATAAAAAAAGGCTTGAT
GAATTAAAGTAGTGAGATTAGGGGATCGGGTGCCACGTTCCGGTACCATGATAGAATATGGATCGGGTGTCACGTTCCGACACCACGATAGAATATGGAT
CGGATGCCACGTTTCGGTACCAGGATAGAATATAGATCGGGTGTCACGTTCCGACACCAGGATAGAATATGGATCGGGTGCCACGCTCCGGTACCAAGAT
AGTATATGAGGATCGGAGTGTCACGTTTCGACACCAGGATAGAATATGGATCGGGTGCCACGTTCTGGTACCAAGATAGTATATGAGGATCGGAGTATCA
CATTTCGACACCAGGATAGAATATGGATCGGGTGCCACATTCCGGTACCATGATAATATATCAGGATCGGAATGTCACGTTCCGACACCCGGATAGAATA
TGGATCTGGTGCCACGTTCCGAAACCACGAATAGAATAACGATCGGATTGTCACCGTTTCCACCACAGTAAATTTATATTTAGGAACTTAATGTTCCTTT
CCCCAATCCGAGGAGGAATAACCATAATGAATCCTTGAAATTATTTTAATAATATCAAATCTG
>LE_HBa0245C22_T7_380175 (trimmed for quality and cloning vector)
TGCAGGCATGCAAGCTTTGGGAAAATTCTTGCTTGATTCCTTCTTCGGTGGAGGTAGGTTATGGTTTTCATGCTATTCGTCCTAAACTCTTAATAGTGAA
TGATATGTGTTAGTAGTATTGATAAACCCTTCTATATGCTTAGATTGTATGCTTGCATGAATGATGTGATTATGTAATTATGAATACAATAAGCATGATG
AAGCTATTGAATCCCAAATCTTAAAAAGAAACCCTAATCTACTTTGTTAATGATGATCCCTTGGTATAAAAAAAGGCTTGATGAATTAAAGTAGTGAGAT
TAGGGGATCGGGTGCCACGTTCCGGTACCATGATAGAATATGGATCGGGTGTCACGTTCCGACACCACGATAGAATATGGATCGGATGCCACGTTTCGGT
ACCAGGATAGAATATAGATCGGGTGTCACGTTCCGACACCAGGATAGAATATGGATCGGGTGCCACGCTCCGGTACCAAGATAGTATATGAGGATCGGAG
TGTCACGTTTCGACACCAGGATAGAATATGGATCGGGTGCCACGTTCTGGTACCAAGATAGTATATGAGGATCGGAGTATCACATTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.972326
Expected error %
0.817872
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0245C22
Clone
Clone name
hba-245c22
LE_HBa0245C22
P245C22
Clone type
BAC
Contamination
none
Estimated length
31,901
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found