Clone Read LE_HBa0245J01_T7_380789

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0245J01_T7_380789
Primer
T7
ID from Seq. Facility
LE_HBa_245_J01-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
414 trimmed for vector and quality, 852 raw
Sequence
>LE_HBa0245J01_T7_380789 (raw untrimmed)
CTCAGCTAACTGCAGGCATGCAAGCTTATTTTTCGAGTTACCCCCCCTCGAGAAATGATACAAAGTAAAAAATTAAAAAAAATTACCCCTCAAAAATAAC
ATCTCATTTTTTTATTTAGTAAAATTATAATAAATATATTATTATCATTGCTATAGATGAATAGTTGGGAAAACTTTTGAATAAAAAACAAAAGATGAAG
AGCACATTCTCCCAACTCCAAGGCCAAATTCAAAAAAAAAAAAAGGCACTACTATTTAATTAATTTAATAAATGTTGTCGGGTGTTGCGCGGAGTGTGAT
TTTCCATGTTCACTTCACACACTACACACATTCAATTAATACAAGTTTTATTATTTTTTCTTTATATTCATCCCTTTTTGCCTCAAGTTAATTTGACAAT
TTGTTTTATAAAAGAAATTATTTGTTAGAGATTTATATTTTTAGAAAAATTTAAATTTAACTATTATTATTTTAATTTGTTACCTAATGATGAGGATATT
TTTATTTGTTAAGAAATAAAAATTCTTCCAATTAAGTTGCCTTCCATAATTTAAAAAATTTAAAATTTTTTAAAATAACGTTCCATTTTATGTTTTAAAT
GCCAGGTAAAAAAAAAACTTTTTTCCCACCGGGCTAAAATTACCGCAACAATAAAATTTTGCCCAATTATTTCCCGTTAAAAGCCGTTTTAATACCAAAA
AACAAGGGGGTAAAAAAAATTAGTACTTCCAAAAACCCCCTACCATAAAACAATTATTTTTCCAAATTTTCCCCCCAACAATATAAAATTTTTTCCCTTA
AAAAAATTATAATTTTTCCCCCTTAATAAAAAATTTACCCGCATTCTCCTCA
>LE_HBa0245J01_T7_380789 (trimmed for quality and cloning vector)
CTTATTTTTCGAGTTACCCCCCCTCGAGAAATGATACAAAGTAAAAAATTAAAAAAAATTACCCCTCAAAAATAACATCTCATTTTTTTATTTAGTAAAA
TTATAATAAATATATTATTATCATTGCTATAGATGAATAGTTGGGAAAACTTTTGAATAAAAAACAAAAGATGAAGAGCACATTCTCCCAACTCCAAGGC
CAAATTCAAAAAAAAAAAAAGGCACTACTATTTAATTAATTTAATAAATGTTGTCGGGTGTTGCGCGGAGTGTGATTTTCCATGTTCACTTCACACACTA
CACACATTCAATTAATACAAGTTTTATTATTTTTTCTTTATATTCATCCCTTTTTGCCTCAAGTTAATTTGACAATTTGTTTTATAAAAGAAATTATTTG
TTAGAGATTTATAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.899538
Expected error %
1.06
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0245J01
Clone
Clone name
hba-245j1
LE_HBa0245J01
P245J01
Clone type
BAC
Contamination
none
Estimated length
101,348
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found