Clone Read LE_HBa0245N21_T7_381269

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0245N21_T7_381269
Primer
T7
ID from Seq. Facility
LE_HBa_245_N21-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
4 trimmed for vector and quality, 860 raw
Sequence
>LE_HBa0245N21_T7_381269 (raw untrimmed)
GCAGGCTGCAAGCTTGAGTATTCTATAGTGTCACCTCCATTGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTCCTTTTGTTATCCGCTCACAATT
CCACACAACATACGATGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTC
CAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGAACCCCTTGCGGCCGCCCGGGCCGTCAACCAATTCTCATGTTTGACAGCTT
ATCATCTAATTTCTGCCATTCATCCGCTTATTATCACTTATTCAGGCGTAGCAACCAGGCGTTTAAGGGCACCAATATCTGCCTTAAAAAAATTACGCCC
CGCCCTGCCACTCATCGCAGTACTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATCACAAACGGCATGAAGAACCTGAATCGCCAGCGGCAT
CAGCACCTTGTCGCCTTGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAACAAGTTGTCCTAATCGGCCACGTTTAAATCAAAACTGGTGATACTC
ACTCATGGATTGTCTGATACGAAAAATATATTCTCTATAAATCCCTTTATGGAAATAGGTCAGGTTATTCCCTTAATCCTTTCCATTCTTGCGATATCTT
TTTTACAATCAGTCCAGAAAATTTCTATTGTTATTCTTCCCATATCTATATTTACCCCTCCATTCTCCATCTATGAAAAATAGTATTTAATAATGGAGTA
ACTCTTTACCACTTATTCACTATATTTTCGTCTTTTTATTTGCCCATATGTATTCCTGAN
>LE_HBa0245N21_T7_381269 (trimmed for quality and cloning vector)
TGCA

This is probably not a useful sequence.

Problems:
  • Low complexity
  • Short cloning insert
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
  • Not screened for contaminants
Quality Report
Processed by
SGN
Vector signature
5' read, short insert
Quality trim threshold
14.5
Sequence entropy
not recorded
Expected error %
3.10435
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0245N21
Clone
Clone name
hba-245n21
LE_HBa0245N21
C01HBa0245N21
P245N21
Clone type
BAC
Contamination
none
Estimated length
111,634
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found