Clone Read LE_HBa0114C15_T7_38141

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0114C15_T7_38141
Primer
T7
ID from Seq. Facility
LE_HBa_114_C15-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
614 trimmed for vector and quality, 789 raw
Sequence
>LE_HBa0114C15_T7_38141 (raw untrimmed)
CTGGGTCCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTACTCTTTTATAATATGGTAATTATCCTTCTATTAATTGATATAACCAATATG
GTGACCATGACATGCTTATTTCTCATTTGAGCACTGAAGAATGGATAGACTCTTTGAAATTGCAAATTGTAGATGATTGGGAGCCGCGGTTTGTTCAAGA
TCAAGTTGCAGGGTTGGTTCCTTTTTTTTATATTGCTCCGACTCTTCAATAATGTTGTTACATAAGTGTGTCGGACACACACATCTGATGATGATATTGT
TGAAGAGTCGGAGCAACATAGTCTTTTTCTTAAACTCACATGTACCAATACTTTTTCTAATAAATACTACTTTGTTTATGTAGATACAAGGTGAAGTATT
TACAAAATGATTATGAGTTGACATATGCAACTCTTAAGGTGACCACTATTCCCTATTGCAACAATCCTAAACCACTATTAACGATGATTTCAAATGTTAT
TAATTGAGTTTCAAACTTAATATATGTACATATTTAATACTCCATTCGTCCCATTTTATGTGACGCTATCCTTTTTGGTCAATTCCAAAAAGAAAGTCAC
ATTTTCTTATATGATAAATATTTTAAAGGTATAATTTCTCTTTTACCTTTGTTTGGTCCCACTTAATTTCCCCCCCCCCTACTATTATATTATTTATGAA
GGAGAGAGAAAAATCGCGTTTTTTTATTTGAAGGGCTCCCCCGCCGCGGTTTTAAAAGTTTTNATTTATTTTTTAATTTTTTGTGTGTN
>LE_HBa0114C15_T7_38141 (trimmed for quality and cloning vector)
AGCTTACTCTTTTATAATATGGTAATTATCCTTCTATTAATTGATATAACCAATATGGTGACCATGACATGCTTATTTCTCATTTGAGCACTGAAGAATG
GATAGACTCTTTGAAATTGCAAATTGTAGATGATTGGGAGCCGCGGTTTGTTCAAGATCAAGTTGCAGGGTTGGTTCCTTTTTTTTATATTGCTCCGACT
CTTCAATAATGTTGTTACATAAGTGTGTCGGACACACACATCTGATGATGATATTGTTGAAGAGTCGGAGCAACATAGTCTTTTTCTTAAACTCACATGT
ACCAATACTTTTTCTAATAAATACTACTTTGTTTATGTAGATACAAGGTGAAGTATTTACAAAATGATTATGAGTTGACATATGCAACTCTTAAGGTGAC
CACTATTCCCTATTGCAACAATCCTAAACCACTATTAACGATGATTTCAAATGTTATTAATTGAGTTTCAAACTTAATATATGTACATATTTAATACTCC
ATTCGTCCCATTTTATGTGACGCTATCCTTTTTGGTCAATTCCAAAAAGAAAGTCACATTTTCTTATATGATAAATATTTTAAAGGTATAATTTCTCTTT
TACCTTTGTTTGGT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.936359
Expected error %
0.405075
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAD01264.1| Score 74 E Value 3e-12 Identity 28.10% Align. Length 113bp (18.40%) Frame 1
glucose acyltransferase [Solanum berthaultii]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0114C15
Clone
Clone name
hba-114c15
LE_HBa0114C15
C04HBa0114C15
P114C15
Clone type
BAC
Contamination
none
Estimated length
103,679
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found