Clone Read LE_HBa0204G17_SP6_383091

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0204G17_SP6_383091
Primer
SP6
ID from Seq. Facility
LE_HBa_204_G17-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
608 trimmed for vector and quality, 972 raw
Sequence
>LE_HBa0204G17_SP6_383091 (raw untrimmed)
CACTTGGCCGCAATGTCAGCTCTTAATGCTGTTGCACAGAGGACCTTATCGTGAAGAACGGACGATTCGGTGGTGTTGTCACTAACTGGTCTTTGGTTTC
CCAGAACCACGACACACAATCCTGCATGGACCCTAATGTTATGGAGGCTAAGATTGTGGTCAGCTCTTGTGGCCACGACGGCCCCATGGGCGCCACCGGT
GTTAAGAGGCTCAGGAGCATTGGCATGATCAACAGTGTCCCTGGAATGAAAGCTTTGGACATGAACGCTGCTGAGGACGCGATTGTTAGACTTACCAGAG
AGGTCGTACCTGGTATGATTGTCACAGGAATGGAAGTTGCTGAAATTGATGGAGCACCACGAATGGTTAGTATGAAATACTTGAACTCCTATATTGTATA
AACTCATAATTAGAAGTTAGAAAAGCAACAAACAATTCAACTAATTGGAGATGTTATACATTGTACAGGGTCCAACTTTTGGAGCTATGATGATATCACG
ACAGAAGGCAGCTCACCTCGCCCTACGAGCGTTGGGATTGCCCAACGCCCTTGATGGAACTGCAGAAACAAGCGTCCTCCCGGAGCTTATGTTGGCTGCA
GCTGATGAAGCTGAAATTGCTGATGCTTGAATGTAATTATAGTTTTCTAAGCAAGGATTATGACGAATATTAGTTTTTCCTACATAAGTGAGTATGGTTG
TGGTGGTGATGATAAATTGTTAAAGAGATGAATGATTCGAATTTTCTATTATAATAGCCTTGTGTATTGTTTGGATCATATTATCTTTAATTGTATTCAT
TACCATACTTATTAAGGAAATATATTATATTCTCTTTTTGCTTGATACATTATTTATCCTTCTACTACTCTTTATGTTATTTCCTTACGTTTGTCTTCCT
CCTTTTCTTTCAACCTTTTATTTTTTCAATTTAATTTTGTTTCATTACTATTATTTAATTTCTTTTTTTTTA
>LE_HBa0204G17_SP6_383091 (trimmed for quality and cloning vector)
GGTGTTGTCACTAACTGGTCTTTGGTTTCCCAGAACCACGACACACAATCCTGCATGGACCCTAATGTTATGGAGGCTAAGATTGTGGTCAGCTCTTGTG
GCCACGACGGCCCCATGGGCGCCACCGGTGTTAAGAGGCTCAGGAGCATTGGCATGATCAACAGTGTCCCTGGAATGAAAGCTTTGGACATGAACGCTGC
TGAGGACGCGATTGTTAGACTTACCAGAGAGGTCGTACCTGGTATGATTGTCACAGGAATGGAAGTTGCTGAAATTGATGGAGCACCACGAATGGTTAGT
ATGAAATACTTGAACTCCTATATTGTATAAACTCATAATTAGAAGTTAGAAAAGCAACAAACAATTCAACTAATTGGAGATGTTATACATTGTACAGGGT
CCAACTTTTGGAGCTATGATGATATCACGACAGAAGGCAGCTCACCTCGCCCTACGAGCGTTGGGATTGCCCAACGCCCTTGATGGAACTGCAGAAACAA
GCGTCCTCCCGGAGCTTATGTTGGCTGCAGCTGATGAAGCTGAAATTGCTGATGCTTGAATGTAATTATAGTTTTCTAAGCAAGGATTATGACGAATATT
AGTTTTTC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.984257
Expected error %
0.832405
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0204G17
Clone
Clone name
hba-204g17
LE_HBa0204G17
P204G17
Clone type
BAC
Contamination
none
Estimated length
119,196
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found