Clone Read LE_HBa0204I05_T7_383233

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0204I05_T7_383233
Primer
T7
ID from Seq. Facility
LE_HBa_204_I05-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
563 trimmed for vector and quality, 909 raw
Sequence
>LE_HBa0204I05_T7_383233 (raw untrimmed)
GCTTTAGTAGACGCCAACCCCGTCAGAGGAGAGGAGATGGGCCCTTAAGATTTGGAGGCAAAATCATAGTCCGAATATTTATGAGATGGGGTCTGGAAAG
TTCTTGTTCAAGTTTGCGATAAGAATCACAGCGGAACAGGTGATTGTAGGCAAATGGGTCTGGAACAACTCAAAAATCTGGCTGCATTGGTGGACTCCCA
CGATAGTGGCCACAAATTGGAAGACTAGACGAGCTCGACCTGGACTTGGGCCGTTGGTCTTCCACTGCATCTCTGGTCGCAAACGACTTTCAAAGACATC
GGAAACTTCTGTGGTAGTTGGATCATAACAGAGGAAGAGACAACTAAGAAACCACCTTAAATGGGCGAGAAGCAGAGTTGAAGGAGGCAGGTTTTCCCTC
TTATTTGCCACGTTAACCTATGGAAAATAATTTTTTGTTAGTATTTTCCTCCAATCAGAGAGCCCTCGATTTTTGTCTCACATTATTTCCTGGCTAATGT
CATCATTGTTATTCCCCTTTTCCCTCCTTTTTCATTTTTACCTGTTTCAACTCCTTCTCCCATCTACACCTTTTAAGGCCCTTATTTTTTTTTATTTTTT
TTTGAACGGGTAAGGTTGTATTCTTCAGCATTAAGGGCATGCTGGCCACCACTAAAAAGTGTCAATTACAAACTTCCTATCCAATCTACAATCTGATCTG
TATCCACTAAGCACAACTGTTTACCCCAAAAAAGTAAATTTACTTTTCCATTCCGGTAGTAAAAATAATTTTTGTCCTTGAAAAAAACCGGGCCCTCTTA
CCAAAAATTCAAAAATCTTTAAATTCTTTCCCCTATTTGGCGGCTAAAAAAGGTATGGGAGGGCCTCAAAACCCCCAAATTTTAATTTCACCCTGTGGGG
GGAAATTAA
>LE_HBa0204I05_T7_383233 (trimmed for quality and cloning vector)
CGCCAACCCCGTCAGAGGAGAGGAGATGGGCCCTTAAGATTTGGAGGCAAAATCATAGTCCGAATATTTATGAGATGGGGTCTGGAAAGTTCTTGTTCAA
GTTTGCGATAAGAATCACAGCGGAACAGGTGATTGTAGGCAAATGGGTCTGGAACAACTCAAAAATCTGGCTGCATTGGTGGACTCCCACGATAGTGGCC
ACAAATTGGAAGACTAGACGAGCTCGACCTGGACTTGGGCCGTTGGTCTTCCACTGCATCTCTGGTCGCAAACGACTTTCAAAGACATCGGAAACTTCTG
TGGTAGTTGGATCATAACAGAGGAAGAGACAACTAAGAAACCACCTTAAATGGGCGAGAAGCAGAGTTGAAGGAGGCAGGTTTTCCCTCTTATTTGCCAC
GTTAACCTATGGAAAATAATTTTTTGTTAGTATTTTCCTCCAATCAGAGAGCCCTCGATTTTTGTCTCACATTATTTCCTGGCTAATGTCATCATTGTTA
TTCCCCTTTTCCCTCCTTTTTCATTTTTACCTGTTTCAACTCCTTCTCCCATCTACACCTTTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.978269
Expected error %
0.153109
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0204I05
Clone
Clone name
hba-204i5
LE_HBa0204I05
C10HBa0204I05
P204I05
Clone type
BAC
Contamination
none
Estimated length
152,452
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found