Clone Read LE_HBa0232J11_T7_383364

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0232J11_T7_383364
Primer
T7
ID from Seq. Facility
LE_HBa_232_J11-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
682 trimmed for vector and quality, 966 raw
Sequence
>LE_HBa0232J11_T7_383364 (raw untrimmed)
CATGGCGGGGACTCTGAGTCGACTGCAGGCAGCAAGCTTTCGCATTTACACCTAGTTACTTTCGATCCTAACAAGTGGTATCAGAGCCAGATTCAATGAT
GGAGTCGAGTTTAATGGTTCGATAATCGATGATTGATCCAGGTTAGAAGGAGATGTTCATTTTGGCGGGTGTAGTTCTAGCCGCAACCTTTTTGACAGTA
ATGAAGATTTTGTTGGAGAAATTATTTCAGGGAGGTTCTCTGTGTTGAGACATAAATTTTTCAAAGGAGATTATAGAGAGGAGAAACAAGTTGTCGAAGA
TTAAGTGAAGAAGGTGGACAAATTTGTTTTGTCAGAAATTCAGGCCAAGTGGGAGATTTTTAGGATTTTATTTGCCCTGATTTCTTACCATAAATAGGTT
TTCCTTTTAAAAAAGGTTTTGGATTGATTAATCCTTTCTTTGGTAGGAAAAGGTTTAGGACTCTATAAATAAAGACATGTTCCTTCTAACTTAAACAGTA
TTCACAATGTAGTCTTAAGGGATTTGAGAGTTTGGGTTAGGGGGAAAATTTGTGGATCACAAGCTAGATACGTTATCACTTGTGTGAACCTCCCATGTAT
TCTGAGTGAATTAGTTGAGGTTGTTTCTCTCTGTATTTTGTACTCTCATATTTATAGTGGATTGATCATCTTCTTTGTGGATGTAGGTCGATTGACCAAA
CCACGTTAAATCTTTGTGTCTTTTGATATGTTTCTTGTTGTCTTCTTACTCGTGATCTTTTGAGTTTTTCTTTGCTAGCTTACGCATTTACCCCTATTCG
TGTTTCTACTTCGGTGGGTGAGTCCGTGGTAGTTGAAAAGGTATATAGGTCTTGGTTGGGGAATTTGTGGGGAACCACACTTATGTAAAATTTGGTATCC
GGGGAAAGGGATGATTTTGAAGGAATTCCGGGGATGAACTTGGCTTTTCTCGGAATTTGCGATCTG
>LE_HBa0232J11_T7_383364 (trimmed for quality and cloning vector)
AAGCTTTCGCATTTACACCTAGTTACTTTCGATCCTAACAAGTGGTATCAGAGCCAGATTCAATGATGGAGTCGAGTTTAATGGTTCGATAATCGATGAT
TGATCCAGGTTAGAAGGAGATGTTCATTTTGGCGGGTGTAGTTCTAGCCGCAACCTTTTTGACAGTAATGAAGATTTTGTTGGAGAAATTATTTCAGGGA
GGTTCTCTGTGTTGAGACATAAATTTTTCAAAGGAGATTATAGAGAGGAGAAACAAGTTGTCGAAGATTAAGTGAAGAAGGTGGACAAATTTGTTTTGTC
AGAAATTCAGGCCAAGTGGGAGATTTTTAGGATTTTATTTGCCCTGATTTCTTACCATAAATAGGTTTTCCTTTTAAAAAAGGTTTTGGATTGATTAATC
CTTTCTTTGGTAGGAAAAGGTTTAGGACTCTATAAATAAAGACATGTTCCTTCTAACTTAAACAGTATTCACAATGTAGTCTTAAGGGATTTGAGAGTTT
GGGTTAGGGGGAAAATTTGTGGATCACAAGCTAGATACGTTATCACTTGTGTGAACCTCCCATGTATTCTGAGTGAATTAGTTGAGGTTGTTTCTCTCTG
TATTTTGTACTCTCATATTTATAGTGGATTGATCATCTTCTTTGTGGATGTAGGTCGATTGACCAAACCACGTTAAATCTTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.949454
Expected error %
0.0655035
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0232J11
Clone
Clone name
hba-232j11
LE_HBa0232J11
C08HBa0232J11
P232J11
Clone type
BAC
Contamination
none
Estimated length
101,185
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found