Clone Read LE_HBa0114G19_SP6_38340

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0114G19_SP6_38340
Primer
SP6
ID from Seq. Facility
LE_HBa_114_G19-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
214 trimmed for vector and quality, 658 raw
Sequence
>LE_HBa0114G19_SP6_38340 (raw untrimmed)
TTTATTTCTATTGCTTTTTATCCTCTTATTATTTTTTATTAATTTTTTTTTCTTATATTTCTTCTTCTTCTTCTTTTTCTTTTTTTTTTTTTTTCCTCCC
A
AGCATACGCTTTGTAGTTCTTATATTAGCAATGTCTTTGCTCATTATCAGCATATCATCTACATATAGGCATAAAATAACTTCCTGATTTGGAGTATCT
TTAATGTAAACACATTATCACATTCATTGATCTTGAATCCATCTGACAACATGGTTTGATCAAACTTTGCATGTCATTGTTTTGGTGCTTGTTTTACTCC
ATAAAGTGACTTAATAAGTTTGCACACTTTCTTTTCTTTACCAGGAACCTACAAAACCCTTTAGGCTGTTCTAAGTCCGATTTAATTCTTCAACCTCTCC
ATTTAATAAGGTTGTTTTCATATCTATTTTAATGAATTTCAATACCACATCACTGCAGCTAGAGCAATCTAATATTCAATTCTTTGTTTATTTTATGCTT
TTGTCTATCTTTTTTCATAATAATCTAAACTTTTCTTTTTTTTTAAAACCTTTGACAATATGCTATATATTAATTCTTCAATAATTCCTTACCCTAGCGT
CCTAACTTTAACTAATCCTTGCTATCCCTTAGTTAATCTACTCTCTCACGAAATATCT
>LE_HBa0114G19_SP6_38340 (trimmed for quality and cloning vector)
AGCATACGCTTTGTAGTTCTTATATTAGCAATGTCTTTGCTCATTATCAGCATATCATCTACATATAGGCATAAAATAACTTCCTGATTTGGAGTATCTT
TAATGTAAACACATTATCACATTCATTGATCTTGAATCCATCTGACAACATGGTTTGATCAAACTTTGCATGTCATTGTTTTGGTGCTTGTTTTACTCCA
TAAAGTGACTTAAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.921794
Expected error %
1.20652
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU89783.1| Score 67 E Value 2e-23 Identity 74.40% Align. Length 211bp (98.60%) Frame 1
putative retrovirus-related pol polyprotein-like [Solanum tuberosum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAA02260.1| Score 66 E Value 9e-13 Identity 76.90% Align. Length 148bp (69.16%) Frame 1
reverse transcriptase [Nicotiana tabacum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0114G19
Clone
Clone name
hba-114g19
LE_HBa0114G19
P114G19
Clone type
BAC
Contamination
none
Estimated length
121,403
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found