Clone Read LE_HBa0204J24_SP6_383404

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0204J24_SP6_383404
Primer
SP6
ID from Seq. Facility
LE_HBa_204_J24-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
675 trimmed for vector and quality, 914 raw
Sequence
>LE_HBa0204J24_SP6_383404 (raw untrimmed)
NGACGTCGCCCTCACCGACAGGTACCATCTCTAAACCCTAAGACCACCCCTAGATGACTGGGCGAAGCCCTAGAGGATTAAACATGTTGACCCTACTTCC
AAAGAAGATGACATCTAATAAATATTTTAGCAAAGGGGATCTACACGCCACATTCATGACATTTCCTATCAAACACAACCCGTCGAGATGGCTCAACTGG
AATATAATGAACCCGATGGCCTAAAAATCATAATGAAAACCACGGGAAGCCAAACCTAAACTCTGTCCACATGGACATCACAATCTACCTAAAATCCATA
TACAACTTGATATATTACCGTCATGAGTTTAATAAGTTGAGAGTGATTGTGATTCTACTGAGAAGTGTCCACTTTGGGGCAAAAAGCTATCACTACTATA
CTAATAGTGGGGCTTCTTACCATATCCTATGTGGGTATCAAATCACACAAGCTCCATGGTTCTCAGATGAAAAACTTCTAGGAAAAACATAAAGTTAGAT
GTTATCAAGTGCTCGATTAAAGGAAAAGGCAAAACTAATATTCTAATAAATCTCCACGTTAAATCCTTTTGAGTAGGAAATAATGTGGGATATTACTACA
CCACTCAAGAAGTTTTATATTGTACTCAAAAGCTGTAAATTCACTTTGTTAAAGACTTACGAATCCAAATTTGTATTGAGAATCACTTGGTGTACCTAAG
CCTCAAATCTTATCGAAGCCATGCCTACAGACCATGTGGTTGCTCTAAACATCCTCAAGGGTCTACCCTTAGATAATGATCACAATAAAGAGTTTACATA
AAAAGGTCCTAATAATATGGGGTTGAGATCCCATTTACATTTCACTGGAATACTTAAAGTTTATTCCATCCAAGAAAAAAGTATTGAAAAAAATCTTTTT
AAGAGGGTGGATCA
>LE_HBa0204J24_SP6_383404 (trimmed for quality and cloning vector)
CCTAAGACCACCCCTAGATGACTGGGCGAAGCCCTAGAGGATTAAACATGTTGACCCTACTTCCAAAGAAGATGACATCTAATAAATATTTTAGCAAAGG
GGATCTACACGCCACATTCATGACATTTCCTATCAAACACAACCCGTCGAGATGGCTCAACTGGAATATAATGAACCCGATGGCCTAAAAATCATAATGA
AAACCACGGGAAGCCAAACCTAAACTCTGTCCACATGGACATCACAATCTACCTAAAATCCATATACAACTTGATATATTACCGTCATGAGTTTAATAAG
TTGAGAGTGATTGTGATTCTACTGAGAAGTGTCCACTTTGGGGCAAAAAGCTATCACTACTATACTAATAGTGGGGCTTCTTACCATATCCTATGTGGGT
ATCAAATCACACAAGCTCCATGGTTCTCAGATGAAAAACTTCTAGGAAAAACATAAAGTTAGATGTTATCAAGTGCTCGATTAAAGGAAAAGGCAAAACT
AATATTCTAATAAATCTCCACGTTAAATCCTTTTGAGTAGGAAATAATGTGGGATATTACTACACCACTCAAGAAGTTTTATATTGTACTCAAAAGCTGT
AAATTCACTTTGTTAAAGACTTACGAATCCAAATTTGTATTGAGAATCACTTGGTGTACCTAAGCCTCAAATCTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.962756
Expected error %
0.13439
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0204J24
Clone
Clone name
hba-204j24
LE_HBa0204J24
P204J24
Clone type
BAC
Contamination
none
Estimated length
99,215
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found