Clone Read LE_HBa0114G19_T7_38341

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0114G19_T7_38341
Primer
T7
ID from Seq. Facility
LE_HBa_114_G19-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
685 trimmed for vector and quality, 776 raw
Sequence
>LE_HBa0114G19_T7_38341 (raw untrimmed)
CTGGGTACCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCCATCTGGTCTTCAGCATATGCTCCCTACTTCCCCGGGATAAAAAGTCTAAC
CATCAGAACAACCTATGTCCTACTGACACTTTAGGGGCACTTTTATCCACAACCATAAAATAAATGAATATAGAAAAAGGTAATTTTCTAACTGTTGAGG
GACTAAAACATTATAATTTATCAAAAGAGGGGACAAAACATTATGCATGAGGAACTTTTGTCCTTTCTTTGTTTATTAAGGCAGATTTTTTGAAATAGAG
TAAAAGGTACATTAAAATGTGGATCGTAACGAGTCAATTTGGTGTTTCGTGAGATTAAGCACAACTTGTCTAAGAATAGTCATGATTTGCTGTGCTATCT
GATCACCCAACTCCCAAGAAAAAAACACGAAAAAAATGTTGGTACAGTTAGGCTGTTAGGCCGACATTAGACTATAAAGCAATCAAGACCAAAATCAAAG
ATGGAAGAATATCATGAAGCCAAACTTGTAACCTTGAGGGAAAAGGGACAAAAGAGACCTTAATCAGGAAATAATAATTTCAACCTTGGGGAAACCAACT
ATCATTGCTCTCATGCTATGATTTTCCTTTAAAAATTGGCAAGTGTACAAAGCAATTTGTGAAGAAACCCCGGCCTCTTTTATGGTGAAAATAAATTTAG
GTAAAACCAAATGAATTTGCTTTTTAACTCCCCCCCGCCTTCCCCTATCATCCACTCCCCCCTATCAATTCATGTG
>LE_HBa0114G19_T7_38341 (trimmed for quality and cloning vector)
AGCTTCCATCTGGTCTTCAGCATATGCTCCCTACTTCCCCGGGATAAAAAGTCTAACCATCAGAACAACCTATGTCCTACTGACACTTTAGGGGCACTTT
TATCCACAACCATAAAATAAATGAATATAGAAAAAGGTAATTTTCTAACTGTTGAGGGACTAAAACATTATAATTTATCAAAAGAGGGGACAAAACATTA
TGCATGAGGAACTTTTGTCCTTTCTTTGTTTATTAAGGCAGATTTTTTGAAATAGAGTAAAAGGTACATTAAAATGTGGATCGTAACGAGTCAATTTGGT
GTTTCGTGAGATTAAGCACAACTTGTCTAAGAATAGTCATGATTTGCTGTGCTATCTGATCACCCAACTCCCAAGAAAAAAACACGAAAAAAATGTTGGT
ACAGTTAGGCTGTTAGGCCGACATTAGACTATAAAGCAATCAAGACCAAAATCAAAGATGGAAGAATATCATGAAGCCAAACTTGTAACCTTGAGGGAAA
AGGGACAAAAGAGACCTTAATCAGGAAATAATAATTTCAACCTTGGGGAAACCAACTATCATTGCTCTCATGCTATGATTTTCCTTTAAAAATTGGCAAG
TGTACAAAGCAATTTGTGAAGAAACCCCGGCCTCTTTTATGGTGAAAATAAATTTAGGTAAAACCAAATGAATTTGCTTTTTAAC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.94546
Expected error %
0.66574
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0114G19
Clone
Clone name
hba-114g19
LE_HBa0114G19
P114G19
Clone type
BAC
Contamination
none
Estimated length
121,403
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found