Clone Read LE_HBa0232L14_T7_383571

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0232L14_T7_383571
Primer
T7
ID from Seq. Facility
LE_HBa_232_L14-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
671 trimmed for vector and quality, 960 raw
Sequence
>LE_HBa0232L14_T7_383571 (raw untrimmed)
GGGGACTCTAGAGTGACCTGCAGGCATGCAAGCTTGCAATAAGATTTAATACGAAAAGAAACTTAGTACAAAATAAATGTATCACAAAAATTATCATTGT
ATCAGAATCTTAGAAGAAATTTAGTACAAAATTAATGTATCACAAAAATTATCATTGGATCAGAATCTTAGTGGGCCTAGAAAGAATGGCCCAGTGTTGC
AGGTAGGCCTTAAATAAACAAATACTGTTTAGCAATAGGAAACTTACATAAATATACTATAAATAAAAAATATTTATGATTTATTGTATTAATAATTTTT
TTCTCACTTGATCACTTTTAATATATTTATAATACACTTCTAATTCATATTACAAAGAATAATTTATTATTCACATATAATACAAGTTTTATTGATGAAT
CACACATTTTAATACACTTCTTACCAACCAAACATAATATATTTTAAAAACAGTTATATTACATATATATATTGCATACTTAATTTATTTTCATACATAT
TGCAGATCGAACATAGTATTGCTATAAATGACAATAAATAAAAAGTATCGCTGAGATCTGTAATTACTTATTAAAAGACACTCATCCAAATAATTTTTCC
TTTAGCGATCATCATCTATTGGGCTATTGGGCCACAATTCATGGATCCAATTTCTGCTGATAACTGGGCCATTGGGCCTCTATATATAGCAATGAGAATA
TAGTATGAATAACTTTCATAAAATACGCTAGTATATGTGTTAATTATTCGATGTATCGATATTTTTAATTAGAAATTACTATATCTTGTCAAAGTTACCC
TTTCCAAAAATTTTAATTGGCCTTTAAATACAATGTATTTAATTTCTAAAAACCATTTTATCTAGCCAATTTTCTTCCATGAAAAAGGGTTACTGAAAGA
ATCCTTTCACAAAACAAAGGTCTTTTTTAAACAAAGGATTAGTTAATTTCCCCTTTTCCA
>LE_HBa0232L14_T7_383571 (trimmed for quality and cloning vector)
CTGCAGGCATGCAAGCTTGCAATAAGATTTAATACGAAAAGAAACTTAGTACAAAATAAATGTATCACAAAAATTATCATTGTATCAGAATCTTAGAAGA
AATTTAGTACAAAATTAATGTATCACAAAAATTATCATTGGATCAGAATCTTAGTGGGCCTAGAAAGAATGGCCCAGTGTTGCAGGTAGGCCTTAAATAA
ACAAATACTGTTTAGCAATAGGAAACTTACATAAATATACTATAAATAAAAAATATTTATGATTTATTGTATTAATAATTTTTTTCTCACTTGATCACTT
TTAATATATTTATAATACACTTCTAATTCATATTACAAAGAATAATTTATTATTCACATATAATACAAGTTTTATTGATGAATCACACATTTTAATACAC
TTCTTACCAACCAAACATAATATATTTTAAAAACAGTTATATTACATATATATATTGCATACTTAATTTATTTTCATACATATTGCAGATCGAACATAGT
ATTGCTATAAATGACAATAAATAAAAAGTATCGCTGAGATCTGTAATTACTTATTAAAAGACACTCATCCAAATAATTTTTCCTTTAGCGATCATCATCT
ATTGGGCTATTGGGCCACAATTCATGGATCCAATTTCTGCTGATAACTGGGCCATTGGGCCTCTATATATA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.903059
Expected error %
0.0381339
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0232L14
Clone
Clone name
hba-232l14
LE_HBa0232L14
P232L14
Clone type
BAC
Contamination
none
Estimated length
114,426
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found