Clone Read LE_HBa0204P02_T7_383887

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0204P02_T7_383887
Primer
T7
ID from Seq. Facility
LE_HBa_204_P02-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
643 trimmed for vector and quality, 858 raw
Sequence
>LE_HBa0204P02_T7_383887 (raw untrimmed)
ACTCTTTAACATTCATTGTACTTGAGAGGGTTACCAACATTAGTTCTTCCGACTATAAACACATTGCACAATAAGGGGTCACATATACTAGGTGTACTAA
TGCAAAGTGCACTAAGGATATCTCATGATTACCAAGAAGGGTGCAATGTACTTTTGGTCTACCGTTACAACAATTTATCATTTCATACATAAAAGGGTTA
CCAACACTAGGACTATGGTCCAAGGCTTCTAATACTTTATTTTCTAGACTCATAATGAAGTGTGTCATTAATCATTGGGTCTTTATCAGTTCAAGACATA
ATATAGAATACATTATTATTCATTTAAAAAGGGTTACCAAGACTATGAGAAGCCTCTTCATGCTCATTACATTCATTCATTCAAGAATAGGATTCCTAAG
CCTACCAATTAAAGGTGCTTGAACGCATTACATTTATTTACACAATAAAAGGCAATAATAGTCTATCAATTCAAAGTTTACAATACATTTTCGAACAATC
CTTCACATTTTATCATCATCATTCATGAGTGCTTAAGTGAGAATAAACCTTTAATCACAAAACAATGAAATTCTAAAAATTCTCATTGTACTTTAATTGA
GGTCCCACACATATATTACACATAATGATAAAACATAGAACCTTCATGCATATATAGGTAAAAGGGAGATATTCATTCATACAATACAATAATATTACAA
GAAAAATAACACCTTCCCCTTTCAAGTGATCAACATAAATTTCACAATTCTAATTTCACAAATAATTTTAAATACTTGGCTTTCAGGCCCTTAATCCCCT
TCATCCACCCATACTAGGTTAATAAAATTTAAGCATTGGGTAAAAATTAAATTTAATN
>LE_HBa0204P02_T7_383887 (trimmed for quality and cloning vector)
ATTCATTGTACTTGAGAGGGTTACCAACATTAGTTCTTCCGACTATAAACACATTGCACAATAAGGGGTCACATATACTAGGTGTACTAATGCAAAGTGC
ACTAAGGATATCTCATGATTACCAAGAAGGGTGCAATGTACTTTTGGTCTACCGTTACAACAATTTATCATTTCATACATAAAAGGGTTACCAACACTAG
GACTATGGTCCAAGGCTTCTAATACTTTATTTTCTAGACTCATAATGAAGTGTGTCATTAATCATTGGGTCTTTATCAGTTCAAGACATAATATAGAATA
CATTATTATTCATTTAAAAAGGGTTACCAAGACTATGAGAAGCCTCTTCATGCTCATTACATTCATTCATTCAAGAATAGGATTCCTAAGCCTACCAATT
AAAGGTGCTTGAACGCATTACATTTATTTACACAATAAAAGGCAATAATAGTCTATCAATTCAAAGTTTACAATACATTTTCGAACAATCCTTCACATTT
TATCATCATCATTCATGAGTGCTTAAGTGAGAATAAACCTTTAATCACAAAACAATGAAATTCTAAAAATTCTCATTGTACTTTAATTGAGGTCCCACAC
ATATATTACACATAATGATAAAACATAGAACCTTCATGCATAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.934001
Expected error %
0.131145
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0204P02
Clone
Clone name
hba-204p2
LE_HBa0204P02
P204P02
Clone type
BAC
Contamination
none
Estimated length
75,735
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found