Clone Read LE_HBa0208N16_T7_385430

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0208N16_T7_385430
Primer
T7
ID from Seq. Facility
LE_HBa_208_N16-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
706 trimmed for vector and quality, 867 raw
Sequence
>LE_HBa0208N16_T7_385430 (raw untrimmed)
GCTACGACGGGGATCTCTGAGTGACCTGCAGGCATGCAAGCTTTTAGGGTCTAAATGATTGGAATCATTTTTAGTTATTCCTAAACACACATAGGGTTTG
GAGAGGAATTCAAGAGGAGGAAAAGAGGAGAAATGGAAGAACAAACCAAGTTTTTTGCAAATCGAGAATATGTTTCGCAAAATTAAGGTATGCAATATTT
CATAGTGTTGGATTTGTCACTTACACTCCAATAATGATTAACCTATTCGAATTTAATCCATAAGATTTGGAGTGTTGAGATCTTGATTAATTCTTGATGA
TTGTTCCATTCGTGAAACTATGATTGTTTGCATGAGTTCTTGAGGAGACAAATTTGTTTATGAGTTTTATTTTTCTTGAGGGGTATTTAGTATATTTTCA
TGTAAATAAGTGTGTTAAACGAATCTGAGAGGTCTGAGAAGAAAGCGTTCAATTCTAGGTGACTTAGGGTAACAAAATGAGACAAGAAAACTCGTTGATT
TTCTGGGAAGAGGCTTAGGGCGCCGCAAACTCAGTGCACCCTAAGTAGTGTTTTGTAGGTTAGGGTTTGTGCCCATCCACCACTCAGTGCACCAGGATCA
CTAGGTCCCGCACCCTTACGTTCTTTCAATTTTAGTCCCCTCGAATCGTAGCCGTGTTTTATACTTGATATCCACAATTAAAATCTTCATTTATTCTTGA
GAGATAAGAATTAAAGTTATAAATCTTGAATTCATAATTTAAATTAAGGTAGATTTAAGTGTAAAGTTTGACAAAGTCCCTTTGAGTATTTTTCAGGGAG
TCTTTCCAAATTACTTATAAATTGTTTCAAGACTCGAGGTAATGAATATGAGATTTATTCCTAACTT
>LE_HBa0208N16_T7_385430 (trimmed for quality and cloning vector)
GCAGGCATGCAAGCTTTTAGGGTCTAAATGATTGGAATCATTTTTAGTTATTCCTAAACACACATAGGGTTTGGAGAGGAATTCAAGAGGAGGAAAAGAG
GAGAAATGGAAGAACAAACCAAGTTTTTTGCAAATCGAGAATATGTTTCGCAAAATTAAGGTATGCAATATTTCATAGTGTTGGATTTGTCACTTACACT
CCAATAATGATTAACCTATTCGAATTTAATCCATAAGATTTGGAGTGTTGAGATCTTGATTAATTCTTGATGATTGTTCCATTCGTGAAACTATGATTGT
TTGCATGAGTTCTTGAGGAGACAAATTTGTTTATGAGTTTTATTTTTCTTGAGGGGTATTTAGTATATTTTCATGTAAATAAGTGTGTTAAACGAATCTG
AGAGGTCTGAGAAGAAAGCGTTCAATTCTAGGTGACTTAGGGTAACAAAATGAGACAAGAAAACTCGTTGATTTTCTGGGAAGAGGCTTAGGGCGCCGCA
AACTCAGTGCACCCTAAGTAGTGTTTTGTAGGTTAGGGTTTGTGCCCATCCACCACTCAGTGCACCAGGATCACTAGGTCCCGCACCCTTACGTTCTTTC
AATTTTAGTCCCCTCGAATCGTAGCCGTGTTTTATACTTGATATCCACAATTAAAATCTTCATTTATTCTTGAGAGATAAGAATTAAAGTTATAAATCTT
GAATTC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.957849
Expected error %
0.146616
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0208N16
Clone
Clone name
hba-208n16
LE_HBa0208N16
P208N16
Clone type
BAC
Contamination
none
Estimated length
58,622
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found