Clone Read LE_HBa0009A08_T7_3855

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0009A08_T7_3855
Primer
T7
ID from Seq. Facility
LE_HBa_009_A08-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
755 trimmed for vector and quality, 922 raw
Genbank Accession
Sequence
>LE_HBa0009A08_T7_3855 (raw untrimmed)
CTTGGGTCCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCTTTTTCGGCCACTGGAATGGACCATTAAGGGTTTTTGTTTTTTTNATTGNT
AANAAGGGNNCCTCTTTCGAGTTTGACAGCACAGAAACGGAGAAAAGCAATAGCGTTGAGGCTGACATCACTGTTGAATCTGCTGTTTGTGAAGGTGATG
AGGCATCTAACACAATCCGTAAAAGTCAATGCTTCAGTCTCGGTGATATAACGAAAATATTCCCGTACAATCTTTTCCATGGTTTCAAAGGCCAGCAACA
CAATATTCTTCCTTTCATCTGCAGCAGCAGCTGTAAAAACCTGCAAAGGTGCGTATAAAGGCCTATCACATCCCAGGTTCCGTTTCAGTACCAACCAAAA
GACAACTATACGGTTAAATATTACTCCCTCTATTCCAATTTATGTCGCACCCTTCCTTTTTGATCTATCCCAAAAAAAATGTCACCTTTCCACAATTAGA
AGCAAGTCAACTTAAAAAACCCTTTTACCTTTAATGAAATGATATATAGCCACAAAAATATCTGAGATTTATTTTAGACCACAAGCCTCTAAAGTCTCTT
TTTCTTAGGATGAGATTAGTGTGTGTGCAAACCATACCCCTACCTTGGGAGGTAGAGAGGTGCTCAAGAAAAAGCATTTTAAAGCAGTTTGAAAAGAAGA
GGAAATTCTATTGCTACCAATACTCTAGTTGTCAGCAGCTGCTAATGATTAAAAAAAAGTGTAAGCACTTGAACTAAGGATGTGATAATTACCATAAAAA
CACTCTTCCACCCCCGATTTTTCATTATTGACACGACTCAGAACCATTTTGAAAAAATACAACGAAACTATCAACCTCCCTTGATTTTCAACCAGAATTA
CCTTTTTTTTGCCATAAACAAA
>LE_HBa0009A08_T7_3855 (trimmed for quality and cloning vector)
AGCTTCTTTTTCGGCCACTGGAATGGACCATTAAGGGTTTTTGTTTTTTTNATTGNTAANAAGGGNNCCTCTTTCGAGTTTGACAGCACAGAAACGGAGA
AAAGCAATAGCGTTGAGGCTGACATCACTGTTGAATCTGCTGTTTGTGAAGGTGATGAGGCATCTAACACAATCCGTAAAAGTCAATGCTTCAGTCTCGG
TGATATAACGAAAATATTCCCGTACAATCTTTTCCATGGTTTCAAAGGCCAGCAACACAATATTCTTCCTTTCATCTGCAGCAGCAGCTGTAAAAACCTG
CAAAGGTGCGTATAAAGGCCTATCACATCCCAGGTTCCGTTTCAGTACCAACCAAAAGACAACTATACGGTTAAATATTACTCCCTCTATTCCAATTTAT
GTCGCACCCTTCCTTTTTGATCTATCCCAAAAAAAATGTCACCTTTCCACAATTAGAAGCAAGTCAACTTAAAAAACCCTTTTACCTTTAATGAAATGAT
ATATAGCCACAAAAATATCTGAGATTTATTTTAGACCACAAGCCTCTAAAGTCTCTTTTTCTTAGGATGAGATTAGTGTGTGTGCAAACCATACCCCTAC
CTTGGGAGGTAGAGAGGTGCTCAAGAAAAAGCATTTTAAAGCAGTTTGAAAAGAAGAGGAAATTCTATTGCTACCAATACTCTAGTTGTCAGCAGCTGCT
AATGATTAAAAAAAAGTGTAAGCACTTGAACTAAGGATGTGATAATTACCATAAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.983626
Expected error %
1.92954
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g38200.1 Score 145 E Value 3e-35 Identity 25.80% Align. Length 290bp (38.41%) Frame 2
68417.m05392 guanine nucleotide exchange family protein similar to Brefeldin A-inhibited guanine nucleotide-exchange protein 2 [Homo sapiens] SP|Q9Y6D5; contains Pfam profile PF01369: Sec7 domain
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g35380.1 Score 120 E Value 6e-28 Identity 22.20% Align. Length 260bp (34.44%) Frame 2
68417.m05026 guanine nucleotide exchange family protein similar to guanine nucleotide exchange factor [Homo sapiens] GI:5456754; contains Pfam profile PF01369: Sec7 domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_195533.1| Score 145 E Value 1e-33 Identity 25.80% Align. Length 290bp (38.41%) Frame 2
guanine nucleotide exchange family protein [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAB80485.1| Score 145 E Value 1e-33 Identity 25.80% Align. Length 290bp (38.41%) Frame 2
guanine nucleotide-exchange protein-like [Arabidopsis thaliana] emb|CAB37560.1| guanine nucleotide-exchange protein-like [Arabidopsis thaliana] pir||T05647 hypothetical protein F20D10.320 - Arabidopsis thaliana
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0009A08
Clone
Clone name
hba-9a8
LE_HBa0009A08
C01HBa0009A08
P009A08
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found