Clone Read LE_HBa0226C05_T7_385707

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0226C05_T7_385707
Primer
T7
ID from Seq. Facility
LE_HBa_226_C05-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
8 trimmed for vector and quality, 853 raw
Sequence
>LE_HBa0226C05_T7_385707 (raw untrimmed)
TGATATAGGGCCGAGGCGGCCTTTTTTTTTTTTTTTTGCTTGTAATTTCTTAATGCCGAAGGTCTTGTTTTTGACCCCTTCCCAAATTCATATTGGAAAA
CGGATGGAGTCTTCGTGTTACCCTGTCTACCAATTTATTAAATTCGCCGGGGAAATTGGTCTCCTCCAGCTGCAATTGTTTTTCCTGACCTCCTAATCTG
GCTTGTCCTTAGTTCATCCTCCTCTGACATACCTCTCTTGGGCTGTGAACATTTGCAGTGCGCTCCTATGGGTTTAAATCTGGTTGACTATTATTAAAGA
CTGGCATAAGGAAAGGGTCTCCGGTCCTGGGACCTGAGGCTCATAGTGGTCAATCCCATGCCAACGAATCCAAAAAAG
GCTTCTTTGCTCCCTGTTCCCT
TTGAACTCGCCCACACTTGAGGGAGGGGACCCCACCCAATGGCAGAAACTTCCCGGACTTTTAAAGGACTTCAAGGCCCAACATTTCAAGCATGGTCTAT
GGATTCAGACAGCCCATGTTTTCCCTGGAGTGCCACTTTAGGCTCTTAGCTCAGACACTGTCTCAAAATGATTGTCTAGAGAAGAGGGATCCCCAAAAAC
ATGATTTCTTCAGGAACTAACTCCCGCTAAGAAAAGGAAACTTCCCTCAACTGGGGAATGGGAAAAATATGAAGTCAATTCAAGCTCCCAATGGTCTACA
AAATCCCAATTTCAAGTAAAAATTTCCAAAAGATGAGATCTTCACCTTCCCAAAGTGTGGACGTGGAAAAAATTTGACAAAACCCAAATGGAGCGATACA
AAGCATGGTTCGGAAAGGTCAAAAATTCATATAGGCCCTAAATTTTAAAAACC
>LE_HBa0226C05_T7_385707 (trimmed for quality and cloning vector)
GCTTCTTT

This is probably not a useful sequence.

Problems:
  • Short cloning insert
  • Low complexity
Warnings:
  • Not screened for repetitive elements
  • Not screened for contaminants
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
not recorded
Expected error %
0.570052
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0226C05
Clone
Clone name
hba-226c5
LE_HBa0226C05
P226C05
Clone type
BAC
Contamination
none
Estimated length
111,735
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found