Clone Read LE_HBa0226D21_SP6_385859

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0226D21_SP6_385859
Primer
SP6
ID from Seq. Facility
LE_HBa_226_D21-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
682 trimmed for vector and quality, 954 raw
Sequence
>LE_HBa0226D21_SP6_385859 (raw untrimmed)
CTTAAGCAGATATTTTCGCTCCAAACCAATCAATGATAATAGGTAAGGAGGTTTACTAAAGTTGTCATTTTCATCATTAAGTTCACCCTCAGCGACATAA
TCTAATACGGCCACACAATATTGTCCCACAGTGTTAGTCATGAACTGAATTCGAATCTCCAAACATTCCTGCTTCTCATAGTCGACATAACCATTTATCT
CTGTGGCATATATGTATTTCAAAAATCTCATTTTCTTTTGAACAATTTTCAGTTCCTTTATAGATCGATGTATTGCAAGTTTTCTTTTGGAATGGCAGGA
CCTACCCTTTTGCAAGAACATCATCAGTACATCATTTAGAAATTTTTCCAGACAATCCATATATTTTGACAGATCAAAATCATTCAACTCATAATTGCGA
CTTAAACTGGCCGTATTACCTTGAAAGAATTCCAACAAATGTGATTCTAGCCTTTCTAGATTAAGGTTAGTTTTACATTTATGTGGAATCCTACCCAACA
CCCGGTGAAGTATTTCCCCAGTCAATTTGGCCATCTTTGTGAGTTTGACTAAGGAATCAGGCAAAAGAACATCATGATACTTTGTAAAGGTTCTAAAAAC
TCTTAGCACCATTTCAAGTTCCTCAATTCGCAATATGTCGAACCAATCCAGATCACCTCCACTCTTGATCCTTCTCAGGTGCTCTAACATTTCCTCAATT
TCATTTTCAGCCATTTTTCTCCCTGCAAGTTCACCAACTTTTCCAATTAGGTTCTTGAAGCCCATCTTAATGCTTTTGAAAAGTTGTACATATTTATAAC
CCTTTGCTCAAATATTATAAAAACTCCCCTAAACTTGGTAAACCCTTCATAATGGATAGTATGAAAAGATACCAACCTATGGCCTAAACATTGGTTGAAG
GTTGGTTAAAAAAAAATTTTTTATTGGTTTAGTTTTGAACGGAATTGGTAATTT
>LE_HBa0226D21_SP6_385859 (trimmed for quality and cloning vector)
GATAATAGGTAAGGAGGTTTACTAAAGTTGTCATTTTCATCATTAAGTTCACCCTCAGCGACATAATCTAATACGGCCACACAATATTGTCCCACAGTGT
TAGTCATGAACTGAATTCGAATCTCCAAACATTCCTGCTTCTCATAGTCGACATAACCATTTATCTCTGTGGCATATATGTATTTCAAAAATCTCATTTT
CTTTTGAACAATTTTCAGTTCCTTTATAGATCGATGTATTGCAAGTTTTCTTTTGGAATGGCAGGACCTACCCTTTTGCAAGAACATCATCAGTACATCA
TTTAGAAATTTTTCCAGACAATCCATATATTTTGACAGATCAAAATCATTCAACTCATAATTGCGACTTAAACTGGCCGTATTACCTTGAAAGAATTCCA
ACAAATGTGATTCTAGCCTTTCTAGATTAAGGTTAGTTTTACATTTATGTGGAATCCTACCCAACACCCGGTGAAGTATTTCCCCAGTCAATTTGGCCAT
CTTTGTGAGTTTGACTAAGGAATCAGGCAAAAGAACATCATGATACTTTGTAAAGGTTCTAAAAACTCTTAGCACCATTTCAAGTTCCTCAATTCGCAAT
ATGTCGAACCAATCCAGATCACCTCCACTCTTGATCCTTCTCAGGTGCTCTAACATTTCCTCAATTTCATTTTCAGCCATTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.949643
Expected error %
0.155815
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0226D21
Clone
Clone name
hba-226d21
LE_HBa0226D21
C09HBa0226D21
P226D21
Clone type
BAC
Contamination
none
Estimated length
108,996
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found