Clone Read LE_HBa0114N01_T7_38641

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0114N01_T7_38641
Primer
T7
ID from Seq. Facility
LE_HBa_114_N01-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
686 trimmed for vector and quality, 730 raw
Sequence
>LE_HBa0114N01_T7_38641 (raw untrimmed)
CCTCCGTCCCGCGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCCAAGCTCGATTCAGATGAAATCCCTTCAAAAGCTCAAGATATCTAATTCC
CCAAAATTAGATACATTTCCAGAAATTGACGGAGATATGCATTACTTGACACTGCTGACTCTGATTTTTACTAGGATAAGAGAAGTGCCTTCATCCATTG
GGCATCTAAGAGGACTCGAATATCTCTATCTGTCAGGTTGTAAGATCTTCTAAGTCTACCAGATTGCCTCTGCAATTTGATGAAACTTCGAAGTCTTTAT
CTCGATGGGTGCAGAAAGCTAGAGAAACTTCCAGAAAACATTGGTGATTTGCAAGATTTACATATGCTTGATGCGAGCGAAGCTGCAATCTCCCAACCAC
CTCCCTCCATCACTAAGCTTGGAAAACTGTGGAGGTTACGATTCTCACATGAACAACAATTTTAACATTCCTCAAGTTTTGTCTTGAATCAAGTATCAGG
TCTATCATCCTTGACATCACTTGATATTAATAATCACAACATCTTGAGTGGACTTCATGAGGATTTAGGATCTTTACACTCTTTGGAAAATTTGAACGCC
CGCGGCAGCAATATTTCCTGTTTACCAAAAAACGTCAAAGGACTCTTACACCTTCAGCATCTGAACGTCCAATTCTGTCAGAATCTTATTGAACTGCCAA
GAGAGCTACCCCAAAATTTAAGGGAGCTAT
>LE_HBa0114N01_T7_38641 (trimmed for quality and cloning vector)
AGCTTCCAAGCTCGATTCAGATGAAATCCCTTCAAAAGCTCAAGATATCTAATTCCCCAAAATTAGATACATTTCCAGAAATTGACGGAGATATGCATTA
CTTGACACTGCTGACTCTGATTTTTACTAGGATAAGAGAAGTGCCTTCATCCATTGGGCATCTAAGAGGACTCGAATATCTCTATCTGTCAGGTTGTAAG
ATCTTCTAAGTCTACCAGATTGCCTCTGCAATTTGATGAAACTTCGAAGTCTTTATCTCGATGGGTGCAGAAAGCTAGAGAAACTTCCAGAAAACATTGG
TGATTTGCAAGATTTACATATGCTTGATGCGAGCGAAGCTGCAATCTCCCAACCACCTCCCTCCATCACTAAGCTTGGAAAACTGTGGAGGTTACGATTC
TCACATGAACAACAATTTTAACATTCCTCAAGTTTTGTCTTGAATCAAGTATCAGGTCTATCATCCTTGACATCACTTGATATTAATAATCACAACATCT
TGAGTGGACTTCATGAGGATTTAGGATCTTTACACTCTTTGGAAAATTTGAACGCCCGCGGCAGCAATATTTCCTGTTTACCAAAAAACGTCAAAGGACT
CTTACACCTTCAGCATCTGAACGTCCAATTCTGTCAGAATCTTATTGAACTGCCAAGAGAGCTACCCCAAAATTTAAGGGAGCTAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.967747
Expected error %
0.758267
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g17680.1 Score 68 E Value 6e-15 Identity 35.30% Align. Length 682bp (99.42%) Frame 1
68418.m02072 disease resistance protein (TIR-NBS-LRR class), putative domain signature TIR-NBS-LRR exists, suggestive of a disease resistance protein.
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g12010.1 Score 62 E Value 3e-14 Identity 29.70% Align. Length 682bp (99.42%) Frame 1
68417.m01911 disease resistance protein (TIR-NBS-LRR class), putative domain signature TIR-NBS-LRR exists, suggestive of a disease resistance protein.
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAD12594.1| Score 94 E Value 4e-18 Identity 14.00% Align. Length 443bp (64.58%) Frame 3
N protein [Nicotiana tabacum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
sp|Q40392|TMVRN_NICGU Score 92 E Value 1e-17 Identity 13.70% Align. Length 443bp (64.58%) Frame 3
TMV resistance protein N gb|AAA50763.1| N
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0114N01
Clone
Clone name
hba-114n1
LE_HBa0114N01
P114N01
Clone type
BAC
Contamination
none
Estimated length
64,654
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found