Clone Read LE_HBa0114P04_SP6_38742

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0114P04_SP6_38742
Primer
SP6
ID from Seq. Facility
LE_HBa_114_P04-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
707 trimmed for vector and quality, 735 raw
Sequence
>LE_HBa0114P04_SP6_38742 (raw untrimmed)
GTTTTGCGCACTGTATTTCCAGTTAGTAGTGATGCCTCCAGTTAAAACAAAAGAACATTTAGATCCATCCTTGAGCTGTCTGTATTCACAGTGCCTCAGT
AGAACAGAGGAGCGGGTTAAGTCGTTACCGTGGCCTTTAGGTTGCAACTCAACTCCTGCCCTCCTAATCATTTGAACATCTTTAGCAGGACCAAGCCCTT
CTGTTGTCTACGTAGGTTTGGTGACTGACGAATCAGATTTTCTTACATTGCACTGTAAACATCAGAATTAAATAACAGGTCGTATCTGATATATGGCAGA
TATTCAGCTATTTCAATGTGTCCTGTTAACTGAATCAAACATTCATAAATCTGATCGGACTGAGGATGTGTCTTGTCTGTAACAAAAAACTCAAAAATAT
TTCCATTTACTTCAACAGAGCTGCAACCAGGTGTTTTTTGTAATCCTCTTTCACCCATCATCTTCCTCACATCTCGTGCCTTATGTTGCATATTTGCTTC
AACATACATGTTAGCAAGTAAGACATAAGTTCCACTATCACCAGGATCCAATTCAAGAAGTTTCAGAGCTGCCTTTTCCCCCATCTCAATGTTCCTGTGA
ACTCGACAAGCGAAAAACAATGCTCCCCATACCGAAGCATCAGCCTCATTTGGCACTCCACGGACAAGCTCATAAGCTTCTTCCAGAAGCCCTGCCCTGC
CCAAAAGGTCCACCATGCAAGCGTAATGTTTAGAT
>LE_HBa0114P04_SP6_38742 (trimmed for quality and cloning vector)
GTTAGTAGTGATGCCTCCAGTTAAAACAAAAGAACATTTAGATCCATCCTTGAGCTGTCTGTATTCACAGTGCCTCAGTAGAACAGAGGAGCGGGTTAAG
TCGTTACCGTGGCCTTTAGGTTGCAACTCAACTCCTGCCCTCCTAATCATTTGAACATCTTTAGCAGGACCAAGCCCTTCTGTTGTCTACGTAGGTTTGG
TGACTGACGAATCAGATTTTCTTACATTGCACTGTAAACATCAGAATTAAATAACAGGTCGTATCTGATATATGGCAGATATTCAGCTATTTCAATGTGT
CCTGTTAACTGAATCAAACATTCATAAATCTGATCGGACTGAGGATGTGTCTTGTCTGTAACAAAAAACTCAAAAATATTTCCATTTACTTCAACAGAGC
TGCAACCAGGTGTTTTTTGTAATCCTCTTTCACCCATCATCTTCCTCACATCTCGTGCCTTATGTTGCATATTTGCTTCAACATACATGTTAGCAAGTAA
GACATAAGTTCCACTATCACCAGGATCCAATTCAAGAAGTTTCAGAGCTGCCTTTTCCCCCATCTCAATGTTCCTGTGAACTCGACAAGCGAAAAACAAT
GCTCCCCATACCGAAGCATCAGCCTCATTTGGCACTCCACGGACAAGCTCATAAGCTTCTTCCAGAAGCCCTGCCCTGCCCAAAAGGTCCACCATGCAAG
CGTAATG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.971271
Expected error %
0.0330014
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g22410.1 Score 180 E Value 6e-46 Identity 19.30% Align. Length 461bp (65.21%) Frame 1
68415.m02657 pentatricopeptide (PPR) repeat-containing protein contains Pfam profile PF01535: PPR repeat
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g13600.1 Score 141 E Value 3e-34 Identity 16.10% Align. Length 434bp (61.39%) Frame 1
68415.m01499 pentatricopeptide (PPR) repeat-containing protein contains INTERPRO:IPR002885 PPR repeats
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAD22358.1| Score 180 E Value 3e-44 Identity 19.30% Align. Length 461bp (65.21%) Frame 1
hypothetical protein [Arabidopsis thaliana] gb|AAL57637.1| At2g22410/F14M13.19 [Arabidopsis thaliana] ref|NP_179827.1| pentatricopeptide (PPR) repeat-containing protein [Arabidopsis thaliana] pir||C84612 hypothetical protein At2g22410 [imported] - Arabidopsis thaliana
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAP53645.1| Score 177 E Value 2e-43 Identity 20.10% Align. Length 416bp (58.84%) Frame 1
putative selenium-binding protein-like [Oryza sativa (japonica cultivar-group)] ref|NP_921358.1| putative selenium-binding protein-like [Oryza sativa (japonica cultivar-group)] gb|AAK50416.1| Putative selenium-binding protein-like [Oryza sativa]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0114P04
Clone
Clone name
hba-114p4
LE_HBa0114P04
P114P04
Clone type
BAC
Contamination
none
Estimated length
138,957
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found