Clone Read LE_HBa0114P04_T7_38743

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0114P04_T7_38743
Primer
T7
ID from Seq. Facility
LE_HBa_114_P04-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
688 trimmed for vector and quality, 736 raw
Sequence
>LE_HBa0114P04_T7_38743 (raw untrimmed)
CCTGGGACCCGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTAGACCATTGAAACTTAACTGTTTTCTGAGTCAACTTGGTCAAAGGAGACGA
GATAGATGAAAACCCCTCAACAAACTTTCTATGGTAGTCAGTCAAATCTAAAAAATTCCTTATATCAGTTGGAGACGTAGGTCTAGGACAACTTTGAACT
GCTTCTATCATTTGGGTATCAACTCTAATCCCATTACCAAAAAACTATGTGGCCCAAGAATGCCACAAATTTAAGCCAAAACTCACACTTGAAGAACTTG
ACATATAACTCTTTATCTTTCAAAGTCTAAAAGACTATTATGAGTTTACTAGCATGATCTTCTTTATTCCTTAAATAAATTAGTATGTCATCAATAAAGA
CAACAACAAACATAAATAAATAAGGTTTGGAGACTCTATTCATAAGATCCATGAATACTGCAGGCGCATTGGTCAACCCAAATGACATGACAAAAAACTC
ATGATGTCCATAATTGATTCTAAAAGATGTCTTTGGAATGTCACATTTCCTAACTTTCAACTGATGGTAGCCTGATCTAAGATCAATTTTCGAAAAGCAG
GAAACACCCCTGAAGCTGATCGAAAAGATCACCTATCCTTGGAAGAGAATATTTATTCCTAATGATAACCTTATTCCACTGACGGTAATCTATGCACCAT
TCCTAAGGGAACTATCATTCTTTCTCATAAACAAAA
>LE_HBa0114P04_T7_38743 (trimmed for quality and cloning vector)
AGCTTTAGACCATTGAAACTTAACTGTTTTCTGAGTCAACTTGGTCAAAGGAGACGAGATAGATGAAAACCCCTCAACAAACTTTCTATGGTAGTCAGTC
AAATCTAAAAAATTCCTTATATCAGTTGGAGACGTAGGTCTAGGACAACTTTGAACTGCTTCTATCATTTGGGTATCAACTCTAATCCCATTACCAAAAA
ACTATGTGGCCCAAGAATGCCACAAATTTAAGCCAAAACTCACACTTGAAGAACTTGACATATAACTCTTTATCTTTCAAAGTCTAAAAGACTATTATGA
GTTTACTAGCATGATCTTCTTTATTCCTTAAATAAATTAGTATGTCATCAATAAAGACAACAACAAACATAAATAAATAAGGTTTGGAGACTCTATTCAT
AAGATCCATGAATACTGCAGGCGCATTGGTCAACCCAAATGACATGACAAAAAACTCATGATGTCCATAATTGATTCTAAAAGATGTCTTTGGAATGTCA
CATTTCCTAACTTTCAACTGATGGTAGCCTGATCTAAGATCAATTTTCGAAAAGCAGGAAACACCCCTGAAGCTGATCGAAAAGATCACCTATCCTTGGA
AGAGAATATTTATTCCTAATGATAACCTTATTCCACTGACGGTAATCTATGCACCATTCCTAAGGGAACTATCATTCTTTCTCATAAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.947816
Expected error %
0.49872
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAV31171.1| Score 205 E Value 2e-84 Identity 81.30% Align. Length 646bp (93.90%) Frame 2
putative polyprotein [Solanum tuberosum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38792.1| Score 203 E Value 4e-84 Identity 79.70% Align. Length 646bp (93.90%) Frame 2
putative gag-pol polyprotein [Solanum demissum] gb|AAT38791.1| putative gag-pol polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0114P04
Clone
Clone name
hba-114p4
LE_HBa0114P04
P114P04
Clone type
BAC
Contamination
none
Estimated length
138,957
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found