Clone Read LE_HBa0228H03_T7_387658

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0228H03_T7_387658
Primer
T7
ID from Seq. Facility
LE_HBa_228_H03-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
774 trimmed for vector and quality, 894 raw
Sequence
>LE_HBa0228H03_T7_387658 (raw untrimmed)
GGGGACTCTAGAGTCGACCTGCAGGCATGCAAGCTTGTCTTTTAGTCTTGTTAGAGATTTGTATGCCTGTAGAAATTAAAGAGAACCTATATCGCTAGAC
AACTTAAATCTTCAAATATTGGACTGACGCGAGTTTAAAAGGAGTAACATGATCAGTGAAGAAGTCATCCTTTAGAAAGGAAGTTTCAAGTATCTTGAGT
CAAAAATCCAAGAATTAGGGAGATCGACTGTTGACAATGATGTCACACATCATATTGGAGTAGGGGATAAAATGGAGACTTTTATCCAGTGTCCCATGTT
ATAAGAATGTGTCACCAAGACTTAAAGGTAAGTTCTACAATAGTTGTTAGACCAACTGTGTTGTATGGGGCCAATCAAGAATTAACACGCTCAAAAGATG
AAAGTAGCATAAATGTGGATGTTAAGATGGAGGTATGAGCATACTAGTGGAGATAAAATTAGGAATGAAGATATAAGGGGCAAGGTGAGAGTGACCTCCG
CGATGGACAAGATGAGGGAAACGAGAGTGAGATGGTTCGGGCATGTGAAGAGGAGAATAGATTCCAAGTTAGGAGGTGCAAGAGGTTGATAGTGACAGAT
CTAAGGAGTGGTAGATCATGTTTAACTCCAGAAAAATTAAACTACAAAGAAGAGGTCTTCAGATTTGTTCAAGATGACTACTATGTGTTATGGAGGATGA
AAGCAATGAACATCTTTTCTTATAGTGCAAGACAACAATAAAACGGTGGCACATGTTCTTTTGTATTTTGAGCATAAATTGGCCTATGCCTAGCTTCTGC
TCTACTATGAATCTTTTGAATCGCTGGATGAATGTGGAAAAGAAAAATGGAGAGGAAGATTATTGGAAGATCATCCAACATGTATTTTGGTAAA
>LE_HBa0228H03_T7_387658 (trimmed for quality and cloning vector)
CTCTAGAGTCGACCTGCAGGCATGCAAGCTTGTCTTTTAGTCTTGTTAGAGATTTGTATGCCTGTAGAAATTAAAGAGAACCTATATCGCTAGACAACTT
AAATCTTCAAATATTGGACTGACGCGAGTTTAAAAGGAGTAACATGATCAGTGAAGAAGTCATCCTTTAGAAAGGAAGTTTCAAGTATCTTGAGTCAAAA
ATCCAAGAATTAGGGAGATCGACTGTTGACAATGATGTCACACATCATATTGGAGTAGGGGATAAAATGGAGACTTTTATCCAGTGTCCCATGTTATAAG
AATGTGTCACCAAGACTTAAAGGTAAGTTCTACAATAGTTGTTAGACCAACTGTGTTGTATGGGGCCAATCAAGAATTAACACGCTCAAAAGATGAAAGT
AGCATAAATGTGGATGTTAAGATGGAGGTATGAGCATACTAGTGGAGATAAAATTAGGAATGAAGATATAAGGGGCAAGGTGAGAGTGACCTCCGCGATG
GACAAGATGAGGGAAACGAGAGTGAGATGGTTCGGGCATGTGAAGAGGAGAATAGATTCCAAGTTAGGAGGTGCAAGAGGTTGATAGTGACAGATCTAAG
GAGTGGTAGATCATGTTTAACTCCAGAAAAATTAAACTACAAAGAAGAGGTCTTCAGATTTGTTCAAGATGACTACTATGTGTTATGGAGGATGAAAGCA
ATGAACATCTTTTCTTATAGTGCAAGACAACAATAAAACGGTGGCACATGTTCTTTTGTATTTTGAGCATAAAT

This is probably not a useful sequence.

Problems:
  • Probable foreign DNA contamination
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.94784
Expected error %
0.0897438
Sequence Annotations 
Automatic Annotations
NCBI UniVec vector sequences (screening/vector/UniVec)NCBI BLAST
gnl|uv|Y14438.1:4678-4775 Score 74 E Value 2e-14 Identity 100.00% Align. Length 36bp (4.65%) Frame 2
Escherichia coli cloning vector plasmid DNA pBHRK18
NCBI UniVec vector sequences (screening/vector/UniVec)NCBI BLAST
gnl|uv|X65305.1:1-137 Score 70 E Value 4e-13 Identity 100.00% Align. Length 34bp (4.39%) Frame 2
Cloning vector pGEM-4Z
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0228H03
Clone
Clone name
hba-228h3
LE_HBa0228H03
P228H03
Clone type
BAC
Contamination
none
Estimated length
97,707
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found