Clone Read LE_HBa0228K07_SP6_387949

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0228K07_SP6_387949
Primer
SP6
ID from Seq. Facility
LE_HBa_228_K07-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
630 trimmed for vector and quality, 857 raw
Sequence
>LE_HBa0228K07_SP6_387949 (raw untrimmed)
CTTTGAGTATACAAGGCCAAAAGTTCTTTAACTTCCACATGCTTCAGAGGTCGCAATAATTTGAAGACGACATCCAGGGAACAAGCTAAAGGTGGAGGTC
AAGCTAACCAAGTCAAGCTTGATTACAAATCCAAGTCAAGTGAGCAACCACAAGGAGGTAACTATGTTAAACCTAATTTTCCTCGACCCTCTATAATTCA
ATGCTTTAGATGTCAAGGAAGAGGACATGTTGCTAGTGAGTGTCCAAAGAGAAGAACAATTGTTGCTCTTCCTGATGAATATAAGTATGAAGATGAAGAT
GAGAGAGAAGTGAAAAATGAGGAGAATGATGTAGGGATAAAGGAGAGAAATGTGCTTTGGGGGATGAAGAAGAAAGGTTAGATGAGAGGGTGAATTTTCT
TGTTTCATGGAGAAGGGAAATTCTTTGATAAATGACGATGAAGAATTGAGCATGAATGTCAATCTTTCATTTTTTATGAGAATAATTGTGGGATCCCTTG
CAAAAGAAGAACTTGACCAAAGGGAAAATTTATTTCATGCAAGGTGCAAAATCCAAGATAAAGGGTTTTCCTTAATCATTGATAGTGGAAGTTGCACCAA
TGTGATGAGTATTTCCTTGGTGGAGCGTATGAAAGTAAAACCCAGTAAGAATCCAAAAACTTATAAGCTACAATGGCTCAATGAGAGTGGAGATAATAAG
GTCCTCAAACAAGCAAGTATTCGGGTTAGTGTGGCAAAATAATATGAGGAATTGGTTTGTGATGTGGTTTCCCGGTTGGCATTGTCACTTACTATTGGGA
GAGACCCTTGGCAATTTGATTAAAATGTTGTGCCCCAATTTTGATCAAACAATTCAC
>LE_HBa0228K07_SP6_387949 (trimmed for quality and cloning vector)
CAAGGCCAAAAGTTCTTTAACTTCCACATGCTTCAGAGGTCGCAATAATTTGAAGACGACATCCAGGGAACAAGCTAAAGGTGGAGGTCAAGCTAACCAA
GTCAAGCTTGATTACAAATCCAAGTCAAGTGAGCAACCACAAGGAGGTAACTATGTTAAACCTAATTTTCCTCGACCCTCTATAATTCAATGCTTTAGAT
GTCAAGGAAGAGGACATGTTGCTAGTGAGTGTCCAAAGAGAAGAACAATTGTTGCTCTTCCTGATGAATATAAGTATGAAGATGAAGATGAGAGAGAAGT
GAAAAATGAGGAGAATGATGTAGGGATAAAGGAGAGAAATGTGCTTTGGGGGATGAAGAAGAAAGGTTAGATGAGAGGGTGAATTTTCTTGTTTCATGGA
GAAGGGAAATTCTTTGATAAATGACGATGAAGAATTGAGCATGAATGTCAATCTTTCATTTTTTATGAGAATAATTGTGGGATCCCTTGCAAAAGAAGAA
CTTGACCAAAGGGAAAATTTATTTCATGCAAGGTGCAAAATCCAAGATAAAGGGTTTTCCTTAATCATTGATAGTGGAAGTTGCACCAATGTGATGAGTA
TTTCCTTGGTGGAGCGTATGAAAGTAAAAC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.944586
Expected error %
0.241306
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0228K07
Clone
Clone name
hba-228k7
LE_HBa0228K07
C03HBa0228K07
P228K07
Clone type
BAC
Contamination
none
Estimated length
87,613
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found