Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Due to a hardware issue, SGN was briefly unavailable earlier today. We apologize for any inconvenience.

Clone Read LE_HBa0228L19_SP6_388089

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0228L19_SP6_388089
Primer
SP6
ID from Seq. Facility
LE_HBa_228_L19-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
769 trimmed for vector and quality, 882 raw
Sequence
>LE_HBa0228L19_SP6_388089 (raw untrimmed)
TTTCCGTGCTCATTCAGGTCTAAGGATCATTAGGCCACGCTTTCACGGTTCGTATTCATACTGGCAATTGAATCAAACGAGCTTTTACGTTTCTCTTACA
CACGCTTTTTCTTTTCTCATTGGGCTCATCTTAGAACACCTACATTATCTTTTAACAGATGTGCCGTCCCAGCAAAACTCCCCACCTGACAATGTCTCCT
TTCTGGATCGGCCCGCAAAGCGAGCCTTGGGTCCAAAAAGAGGGGCAGTGCCCCGCTTTCGATTCACGGAATAAGTAAAATAACATTAAAAGTAGTGGTA
TTTCACTTACGTCTTTTAGCTCCCACCTATACTACACCTTTCAAGTCATTTGACAAAGTCGGACTAGAGTCAAGCTCAAAAGGGTCTTCTTTCCCTGCTG
ATTCTTCTAAGCCCGTTCTATTGGTTGTGGTTTCGCTGGATAGTAGAAAGGCACACACGAAATCTCGTTAATCCATTCATGCTCGTCACTAATTAGATGA
CGAGGCATTTGACTACCATAAGAGAGTCATAGTTACTCCAGCCATTTACCCGCGCTTGGTTGAATGTCTTCACTTTGACATTCAGAGCACTGGGCAGAAA
TCACATTGCGTAAACATCCGTTGGGACCATCGCAATGCTTTGTTTTAATTAAATAGTCAGATTCCCCTTGTTCGTACCAGTTCTGAGTTGGCTGTTCGAC
GTCCTGGGAAGTCCCCCGAAGGAACCGTTCCTTGTCCGTCCCCAATCCGGCACGCGGTGACCGGCTTTCACCGCGGGAGCAGCTCGTTCAGTCCACGACG
GGTTCGGGACTGGGATCCCGTGCCCATCCCTCAGAGCAAATCCTTTTCCCGTAGTTACGGATCCACTTTGCAGACTTTCCTN
>LE_HBa0228L19_SP6_388089 (trimmed for quality and cloning vector)
AGGATCATTAGGCCACGCTTTCACGGTTCGTATTCATACTGGCAATTGAATCAAACGAGCTTTTACGTTTCTCTTACACACGCTTTTTCTTTTCTCATTG
GGCTCATCTTAGAACACCTACATTATCTTTTAACAGATGTGCCGTCCCAGCAAAACTCCCCACCTGACAATGTCTCCTTTCTGGATCGGCCCGCAAAGCG
AGCCTTGGGTCCAAAAAGAGGGGCAGTGCCCCGCTTTCGATTCACGGAATAAGTAAAATAACATTAAAAGTAGTGGTATTTCACTTACGTCTTTTAGCTC
CCACCTATACTACACCTTTCAAGTCATTTGACAAAGTCGGACTAGAGTCAAGCTCAAAAGGGTCTTCTTTCCCTGCTGATTCTTCTAAGCCCGTTCTATT
GGTTGTGGTTTCGCTGGATAGTAGAAAGGCACACACGAAATCTCGTTAATCCATTCATGCTCGTCACTAATTAGATGACGAGGCATTTGACTACCATAAG
AGAGTCATAGTTACTCCAGCCATTTACCCGCGCTTGGTTGAATGTCTTCACTTTGACATTCAGAGCACTGGGCAGAAATCACATTGCGTAAACATCCGTT
GGGACCATCGCAATGCTTTGTTTTAATTAAATAGTCAGATTCCCCTTGTTCGTACCAGTTCTGAGTTGGCTGTTCGACGTCCTGGGAAGTCCCCCGAAGG
AACCGTTCCTTGTCCGTCCCCAATCCGGCACGCGGTGACCGGCTTTCACCGCGGGAGCAGCTCGTTCAG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.987308
Expected error %
0.269117
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0228L19
Clone
Clone name
hba-228l19
LE_HBa0228L19
C02HBa0228L19
P228L19
Clone type
BAC
Contamination
none
Estimated length
118,063
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found