Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Due to a hardware issue, SGN was briefly unavailable earlier today. We apologize for any inconvenience.

Clone Read LE_HBa0228L19_T7_388091

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0228L19_T7_388091
Primer
T7
ID from Seq. Facility
LE_HBa_228_L19-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
800 trimmed for vector and quality, 880 raw
Sequence
>LE_HBa0228L19_T7_388091 (raw untrimmed)
GATGACGGGGACCTCAGAGTCACCTGCAGGCATGCAAGCTTGAGTAAGAATGAAGAGAAAAGAGATAACGCTAAAGAACTCTCACAACCTTGCTATTTAT
CATGTAATCCCCCACATAAGGGAAAAGCAATCTAAAACTATCATGCTCACAACACAAGGAATTTCAACACCATATTTACAACAAAAGGAAATATGAGTTA
CTGGTGCCTTCACAGGAATTAGCCCCCTTATCCTCTTTAGCTTGAAGATCATGGAAACAAGTCTTCTTTTGATCATCAACATTTGGACCATTAAGAGAAG
ATTGTTTGCCATCCCTTTCTTTAGTAGAAAGAGTAGGGAAATATCTCATTTTGTGGTCATTCTTTCCACAATCATAGCACCTAATAGCACTGGCTAGATA
CTTCCCAAAATGTTTGTAAGTAGGTTTAGAAACTTGATATCCACCACCTATCTCTTGGTTACCCTTAGGAGAACTTGAAGAGTCTTTGTTTGGTTCTTCT
CTCTTCTTGAACCTGGGTTAAACTTGCTCATTGGATCTAACCCTCTTCAAATCCCCATTCATCCTCTTAAGCTTGGAATCCTTAATATATTGAGGATACA
CAAAAAATTTTGAAGGTTCATATAATCATGGACCATCATCGTACAACACTCGAACTTAACTAGGTCGGATACACCGGTAACGAACTTATTCCTCTTATCT
CTAGGGTTAGACACCAAGGATTGAGAATACTTAGACAATTGGGTAAACTTCAAGGAATACTTCTCAACATTAATGCTATTTTTTCAAAGTTTTACGGACT
CCTCAATCTTCACTACCTCTTCTTACGGGGAAAGCACTTACTAAGAATCACCATCTTAAACTCTTCCCATTCTATAGGTT
>LE_HBa0228L19_T7_388091 (trimmed for quality and cloning vector)
CTGCAGGCATGCAAGCTTGAGTAAGAATGAAGAGAAAAGAGATAACGCTAAAGAACTCTCACAACCTTGCTATTTATCATGTAATCCCCCACATAAGGGA
AAAGCAATCTAAAACTATCATGCTCACAACACAAGGAATTTCAACACCATATTTACAACAAAAGGAAATATGAGTTACTGGTGCCTTCACAGGAATTAGC
CCCCTTATCCTCTTTAGCTTGAAGATCATGGAAACAAGTCTTCTTTTGATCATCAACATTTGGACCATTAAGAGAAGATTGTTTGCCATCCCTTTCTTTA
GTAGAAAGAGTAGGGAAATATCTCATTTTGTGGTCATTCTTTCCACAATCATAGCACCTAATAGCACTGGCTAGATACTTCCCAAAATGTTTGTAAGTAG
GTTTAGAAACTTGATATCCACCACCTATCTCTTGGTTACCCTTAGGAGAACTTGAAGAGTCTTTGTTTGGTTCTTCTCTCTTCTTGAACCTGGGTTAAAC
TTGCTCATTGGATCTAACCCTCTTCAAATCCCCATTCATCCTCTTAAGCTTGGAATCCTTAATATATTGAGGATACACAAAAAATTTTGAAGGTTCATAT
AATCATGGACCATCATCGTACAACACTCGAACTTAACTAGGTCGGATACACCGGTAACGAACTTATTCCTCTTATCTCTAGGGTTAGACACCAAGGATTG
AGAATACTTAGACAATTGGGTAAACTTCAAGGAATACTTCTCAACATTAATGCTATTTTTTCAAAGTTTTACGGACTCCTCAATCTTCACTACCTCTTCT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.959586
Expected error %
0.133408
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0228L19
Clone
Clone name
hba-228l19
LE_HBa0228L19
C02HBa0228L19
P228L19
Clone type
BAC
Contamination
none
Estimated length
118,063
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found