Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Clone Read LE_HBa0215N15_SP6_389234

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0215N15_SP6_389234
Primer
SP6
ID from Seq. Facility
LE_HBa_215_N15-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
825 trimmed for vector and quality, 978 raw
Sequence
>LE_HBa0215N15_SP6_389234 (raw untrimmed)
NNCCGATTATCTTAGCTCTATCAGACTCTTTCATTGTGTGCTTAGTAGGGCCACGTATTAATCGGAATTTGCACTATCATTCCGCTGACCATCCACACAT
CCCCAACTTTCCTTTATGTGCATGCAGACTATGTGAAGCTCACATGTGTAGAGTCTATATGTAAAAATATAACCCCAAAAAGAAATTGTACAGTGTGTAT
TCATTTCTAGCTCAAAAGCAAACATCAGCTTGGCCACAAATCAAAAGAACTAGCAAGCACATAAATAGACAATACATAAGCATCCGAAGATGAATGTAGC
AAACTCTCACCAGAGTCTAAAACAAGCCTTCCCACATGCCTAAAACTGATTTAACCCAAAAAACCAACCACAAACTCATATCTTTCTAATCCAATGTAGC
AAACTCACAATAGAAAGTCTAAAACAAGCCTTCCCCATGCCTAAAACTGATTTAACCAAAATAACAAACAACAAGCTCATATCTTTCTAGTCCAACAGAG
CAAACTCACAATTAGAAAGTCTAAAACAAGCCTTCTCACATGCCTAAAACAGATTTAACCAAAACAAAACAATCTCATATCTTTCTATTCCAACATAGCA
AACTAACAATAGAACGTCCAAATCAAGCCTTCCCCCATGCCTAAAACTGATTTAACCAAAATAAACAAACAATAAGCTCATATCTTTCTAGTCCAACATA
GCAAACTCACAACAGAAAGTCTAAAACAAGCCTTCTCACATGCCTAAAACGGATTTAACCAAAACTAAATAACAAGCTCATGTCTTTCTATTCCAACGTA
GCAAACTCACAATAGAACGTCCAAACCAAGCCTTCCCGCATGCCCAAAACTGATTTTACCAGCAAAACCAAACACAAGCACATATCTTTCCAATCAAAGT
AGCAAACTCGCAATAGAAAGTCTTAAACAAGTACTTCCCCTGCCCAAAACTGATCTACCAAAAAAAAAATCTACCTTA
>LE_HBa0215N15_SP6_389234 (trimmed for quality and cloning vector)
TTTCATTGTGTGCTTAGTAGGGCCACGTATTAATCGGAATTTGCACTATCATTCCGCTGACCATCCACACATCCCCAACTTTCCTTTATGTGCATGCAGA
CTATGTGAAGCTCACATGTGTAGAGTCTATATGTAAAAATATAACCCCAAAAAGAAATTGTACAGTGTGTATTCATTTCTAGCTCAAAAGCAAACATCAG
CTTGGCCACAAATCAAAAGAACTAGCAAGCACATAAATAGACAATACATAAGCATCCGAAGATGAATGTAGCAAACTCTCACCAGAGTCTAAAACAAGCC
TTCCCACATGCCTAAAACTGATTTAACCCAAAAAACCAACCACAAACTCATATCTTTCTAATCCAATGTAGCAAACTCACAATAGAAAGTCTAAAACAAG
CCTTCCCCATGCCTAAAACTGATTTAACCAAAATAACAAACAACAAGCTCATATCTTTCTAGTCCAACAGAGCAAACTCACAATTAGAAAGTCTAAAACA
AGCCTTCTCACATGCCTAAAACAGATTTAACCAAAACAAAACAATCTCATATCTTTCTATTCCAACATAGCAAACTAACAATAGAACGTCCAAATCAAGC
CTTCCCCCATGCCTAAAACTGATTTAACCAAAATAAACAAACAATAAGCTCATATCTTTCTAGTCCAACATAGCAAACTCACAACAGAAAGTCTAAAACA
AGCCTTCTCACATGCCTAAAACGGATTTAACCAAAACTAAATAACAAGCTCATGTCTTTCTATTCCAACGTAGCAAACTCACAATAGAACGTCCAAACCA
AGCCTTCCCGCATGCCCAAAACTGA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.926544
Expected error %
0.272126
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0215N15
Clone
Clone name
hba-215n15
LE_HBa0215N15
P215N15
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found