Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Clone Read LE_HBa0215N15_T7_389236

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0215N15_T7_389236
Primer
T7
ID from Seq. Facility
LE_HBa_215_N15-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
778 trimmed for vector and quality, 1008 raw
Sequence
>LE_HBa0215N15_T7_389236 (raw untrimmed)
NNGGTATGTCGGGGATCTCTGAGTCGACCTNAGGCATGCAAGCTTTTTAGTTGTGATCTTCATGTCCTTTCCGAGAGCTTTTCAATTTTTGAAAACTTGC
ATCTGATTTTATACTAATGTTCTAACTTTTGGCTTTACGATTTTGGTCAATCTTTGCTCATTATAACTGTGTCTTTCCTGCTTTTAGATGACAATGAATT
TGAGGAAGTGAATATCGTGAAACCAAATGATGAATTTTAGCAGCCTCACGATTCAGATGGTGGTGCAAATTGGTGACAACGTACATTCTGGCAACATCTA
ATCCTCAACAAATATCTGTATACTTGTAAACTGGGAATTGATTGACCTGCATCTGGTTCTTCTAAAATACTCAGATAGCCTTGAGTTTCATGCTGTAGGG
AAGTTTGTGATATCATTGCGGTTCTGTTTAGCATTATACTGTTCAAGAGAACCACTTCTTATGATTTTTGCAACGATGAGAGCTCTGAGTTACATATACA
GACATAATACATCAACTTTTTTTTAGTAGGATTAGACTTTTCATGGATGTATGAGAATTGCTGGCTTAAGTGTGATTTGTCATGTTCCTTTATCTTCTTG
GTTGCATGACCACTCCCACCTCCTTTTTCCACCGCGGGTTGTTCAAAATCGAACCAAAATGGTGCTATTGATTTACTAGTATTTGGTAACAATCTGGAAT
TCTGCATTAACCACTCCTCTTCCCTAAGCATTTTTGGGTAGTATGTAGGGACAGGTTCAAATCATACAAATATTAGTCAGACTCTTAGATCTTGCAATTC
ACCTTTAACCTAAGGTATCAGGTTTAAACCTCCAGAATATATCCTCATTCGGTGTTTATACCAAACTAAAGGATAAAATGATGTGTATCTACTTATTCAC
CTAGTTGCTTTGTTTGGTATAAACACCAAAGGGGGTAAGGTTTCTTCCCCGCGAATATGTTGTTAAATTTATTCCAAAAACGGAACCTCCGGGCCTTTGT
GGAATAAN
>LE_HBa0215N15_T7_389236 (trimmed for quality and cloning vector)
GCATGCAAGCTTTTTAGTTGTGATCTTCATGTCCTTTCCGAGAGCTTTTCAATTTTTGAAAACTTGCATCTGATTTTATACTAATGTTCTAACTTTTGGC
TTTACGATTTTGGTCAATCTTTGCTCATTATAACTGTGTCTTTCCTGCTTTTAGATGACAATGAATTTGAGGAAGTGAATATCGTGAAACCAAATGATGA
ATTTTAGCAGCCTCACGATTCAGATGGTGGTGCAAATTGGTGACAACGTACATTCTGGCAACATCTAATCCTCAACAAATATCTGTATACTTGTAAACTG
GGAATTGATTGACCTGCATCTGGTTCTTCTAAAATACTCAGATAGCCTTGAGTTTCATGCTGTAGGGAAGTTTGTGATATCATTGCGGTTCTGTTTAGCA
TTATACTGTTCAAGAGAACCACTTCTTATGATTTTTGCAACGATGAGAGCTCTGAGTTACATATACAGACATAATACATCAACTTTTTTTTAGTAGGATT
AGACTTTTCATGGATGTATGAGAATTGCTGGCTTAAGTGTGATTTGTCATGTTCCTTTATCTTCTTGGTTGCATGACCACTCCCACCTCCTTTTTCCACC
GCGGGTTGTTCAAAATCGAACCAAAATGGTGCTATTGATTTACTAGTATTTGGTAACAATCTGGAATTCTGCATTAACCACTCCTCTTCCCTAAGCATTT
TTGGGTAGTATGTAGGGACAGGTTCAAATCATACAAATATTAGTCAGACTCTTAGATCTTGCAATTCACCTTTAACCT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.956747
Expected error %
0.184908
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0215N15
Clone
Clone name
hba-215n15
LE_HBa0215N15
P215N15
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found