Clone Read LE_HBa0229J06_SP6_389380

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0229J06_SP6_389380
Primer
SP6
ID from Seq. Facility
LE_HBa_229_J06-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
8 trimmed for vector and quality, 1084 raw
Sequence
>LE_HBa0229J06_SP6_389380 (raw untrimmed)
NNNNGGCACACTAAANNGNNNNTNCCCAAAAACGNNAGAATCGTAATAGCCCCAATACTCCATATGTTGAACCCTTTAAGAAAGAGAAATACCGGAATCG
AGTCGACTAAGACCTACTACAATTCGGCGAA
CAAAAATTCAATCATTGTGGGTCTGAAACTGCAAAGGACATGATTAAATCTGGTGGAAACTCACTGAAA
AAAGTGGGGAGAAGTGTGTGTGAACTAATGGGACGCAGAAGCATCTCATGTACCTTGATAGGGATCACCCGGATGAATTCCACTCCACGATCTTGATTTT
GATGATGAATTCTTGGTCTTTACCCTTCTACTTTTACACTGTCACTTTAGCTCACAAACCCGTAAGCGCGGAGTGAAATTTTCATGAAACTAAGCTTAGG
CTTACTTGTGTACCCATACATGTGTCTCTCAAACCGGAGATTAAGGAAGATAATTATGGTAGAAAAACCTACTTTACTCTTGCGCAACGATTCAGATGGG
TGACCATTCACCCAATCGAGGGACACGCAACTACGCGATAAGACATGTCTCCCTGCATGCAATTGTTGAGTATAGCACATAAATTTAGTGATGTCCGGGA
AGATCATTGCCTTTGGTTTTACCAACCCTTATGTAAAGTCATACTTCTACTTGACTCATGAATTTACAAGGCTGTAACCGTATAAATGGGTGACATATAC
TTCGCTTTCAGTTATGAGTTACCTTAAAATAATGTTCCGTTAATTTACCCTTATTCTTTTCGAGGAATCGACTATCTGCTTAGTAACTGAATCTTATCTA
TTTCGACTTATATAGAATGGTCCATATATCTGTATCGAAAAGATTTAAAAAAGATTGTCCCTCGTGCGCTAATCTTAAACTATCTTCTTCTTGAATACCA
TGTTTTCATTTAATTTCATTCAACATATCTATAAAGTTTATTCTTCTAATCCGGTTGAACTCTTTTATTCTGATAAATCTTTATTTTTATTTACCCCCCC
AAAAATGTTTAGTCTATACCTCCATTCAAACCTCAACTTACTTTCTGCGTTAAGATGCGAATATGTACCATATTTTTTTATTTG
>LE_HBa0229J06_SP6_389380 (trimmed for quality and cloning vector)
CAAAAATT

This is probably not a useful sequence.

Problems:
  • Short cloning insert
  • Low complexity
Warnings:
  • Not screened for contaminants
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
not recorded
Expected error %
0.645436
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0229J06
Clone
Clone name
hba-229j6
LE_HBa0229J06
P229J06
Clone type
BAC
Contamination
none
Estimated length
101,639
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found