Clone Read LE_HBa0233E24_SP6_390484

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0233E24_SP6_390484
Primer
SP6
ID from Seq. Facility
LE_HBa_233_E24-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
274 trimmed for vector and quality, 878 raw
Sequence
>LE_HBa0233E24_SP6_390484 (raw untrimmed)
TCATCAGAGGGGGNNCCNGCTTNNANANCAAAGNAANCNGCAATTAAAAGAACCCCACCANTTTAGGGCNAANNAANAANNAAACNCGGGAAAANAAGNC
NCANCAACGAGGTTTTTTTTCAGGGAGTCAACTAGNAACTTCCCCGAACNCNNCGAAGGGGGGGGGAGANGNCAN
ATTTGAGGTTACAAAAAAAAATGGC
ATTACGTGTAAAATAAATAAAAATTAAATTGTTTCTGAATATAGAATAAGGGTGTTGTTTTTGAATTTTTGAACAAACTAAAACGAAAAATGTGTTACAT
AATGGAATTAGTTTTACCTGGAGTTGAGATTCGAGATATTCAAGAATAATTGCGGGAATAATTCCTCTAATTCCACCTCCATCGAGACGGGAGAGTGTTA
TGAGTTTACCATAAGTTGGAGGTTGCAACCTTAATGAACCACTTGATGATAACAGGACATTCTTCANTAGGTAGGTTTAACTTGCGATGAACATACAAAA
CCCACTTACATAATACTGCCAAGAGTCAATGAAACAAGCAAACCTCTAGAAAAACATNGATCAAACGTAATATCGACAAACCCAACAAACGGCAAACCAT
CGATCTAAAGGCCCCAACACACAGCAAAAAGGTGCCGCCTCAACCTGGAAAACGTGGAAAAAAACCGGGAGAAAGACACACATCCAAACGAAGTCGCAAA
AAAACACAAAGAGGGAAGACCACGGAAAGAACGAACACCAGAAACCAGGCAAAGAAGAACCCACCAAGAAAGGGGCGGGACAAAAAACCCCCCCCCGCAC
CAACAAACAAAGGCAAGAAAAACAACCGGAAAAACCCCCGCCCACCCNACGCAAAAAGCCCGAGCGGAAAAAAACTCT
>LE_HBa0233E24_SP6_390484 (trimmed for quality and cloning vector)
ATTTGAGGTTACAAAAAAAAATGGCATTACGTGTAAAATAAATAAAAATTAAATTGTTTCTGAATATAGAATAAGGGTGTTGTTTTTGAATTTTTGAACA
AACTAAAACGAAAAATGTGTTACATAATGGAATTAGTTTTACCTGGAGTTGAGATTCGAGATATTCAAGAATAATTGCGGGAATAATTCCTCTAATTCCA
CCTCCATCGAGACGGGAGAGTGTTATGAGTTTACCATAAGTTGGAGGTTGCAACCTTAATGAACCACTTGATGA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.924025
Expected error %
0.996909
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0233E24
Clone
Clone name
hba-233e24
LE_HBa0233E24
C04HBa0233E24
P233E24
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found