Clone Read LE_HBa0115F17_T7_39057

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0115F17_T7_39057
Primer
T7
ID from Seq. Facility
LE_HBa_115_F17-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
789 trimmed for vector and quality, 907 raw
Genbank Accession
Sequence
>LE_HBa0115F17_T7_39057 (raw untrimmed)
ATCAATCCGGTCCCCGGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTATTTTGTTCCCTCTTTGAGGAATTCATTTCTTGCTTTTGAAGCTTCA
CTAGGACTTTCTTATTTTGGAACCCCCACTTATCCTTTTGTGACCTCTTTAATGGATTGAATTTCCTTATCTCTGACTCTTTTAGCATCATGGCAGTTTA
ATCTTCAACACTGAAATGAAATATGCAGGATGATCGTGTTGCTACTGCATGGCTAAACAATGAAGATGTTCGTAAAGCAATTCATGCTGAACAAGTAAGA
TACAATTTTCTTGTCTTGTACTAGCTTTAAAGATGATGATTTACCTTTACAAAAACCAAAACAAAAAAATAAAGTTGGTGATTTATGGTTCAATGCTATG
ATACAACAGACAACGTTGATAGGTCCATGGGAGCTATGCACAGACAAAATAGGTCTAAGTCATGATTCTGGAAGCATGATTCCGTATCACAAAAACCTCA
CAGCTCGGGGATATCGGGCACTCATATACAGGTTCAATAGATTACTAAGTCTCTAACTGCCCTCTATGCTTTTTTTTTCTTTCTTTTGAATTACAGCTAA
AACTTCTTGTCCTGTGCATTTCATGTATATTCTATTGTCTAAGTGCCTAAAGCACATACTTATTGGGATTAGAAAACTACTTGGTTTCTCGAATACAATA
GCCCCCCATTTTAAGTACACACTACTCATGAAATTAAAAAAAAATAGTTTTAAGTTTTACAACTATCTCTTACCAGATAGCAGGTAGATATTACATACTG
GGGACTGGGGAGATGTGAAAACAAAGAATACAAATAATACGAATCTGACCTCATTTTTGGTTTCTTTTGCTCCAATTTAAAATGCCTGTTGAAAATGTAA
AGACCTT
>LE_HBa0115F17_T7_39057 (trimmed for quality and cloning vector)
AGCTTATTTTGTTCCCTCTTTGAGGAATTCATTTCTTGCTTTTGAAGCTTCACTAGGACTTTCTTATTTTGGAACCCCCACTTATCCTTTTGTGACCTCT
TTAATGGATTGAATTTCCTTATCTCTGACTCTTTTAGCATCATGGCAGTTTAATCTTCAACACTGAAATGAAATATGCAGGATGATCGTGTTGCTACTGC
ATGGCTAAACAATGAAGATGTTCGTAAAGCAATTCATGCTGAACAAGTAAGATACAATTTTCTTGTCTTGTACTAGCTTTAAAGATGATGATTTACCTTT
ACAAAAACCAAAACAAAAAAATAAAGTTGGTGATTTATGGTTCAATGCTATGATACAACAGACAACGTTGATAGGTCCATGGGAGCTATGCACAGACAAA
ATAGGTCTAAGTCATGATTCTGGAAGCATGATTCCGTATCACAAAAACCTCACAGCTCGGGGATATCGGGCACTCATATACAGGTTCAATAGATTACTAA
GTCTCTAACTGCCCTCTATGCTTTTTTTTTCTTTCTTTTGAATTACAGCTAAAACTTCTTGTCCTGTGCATTTCATGTATATTCTATTGTCTAAGTGCCT
AAAGCACATACTTATTGGGATTAGAAAACTACTTGGTTTCTCGAATACAATAGCCCCCCATTTTAAGTACACACTACTCATGAAATTAAAAAAAAATAGT
TTTAAGTTTTACAACTATCTCTTACCAGATAGCAGGTAGATATTACATACTGGGGACTGGGGAGATGTGAAAACAAAGAATACAAATAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.949157
Expected error %
0.604099
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g25420.1 Score 54 E Value 1e-13 Identity 59.50% Align. Length 300bp (38.02%) Frame 2
68416.m03161 serine carboxypeptidase S10 family protein similar to serine carboxypeptidase I precursor (SP:P37890) from [Oryza sativa]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAF44708.1| Score 83 E Value 9e-15 Identity 21.30% Align. Length 182bp (23.07%) Frame 3
wound-inducible carboxypeptidase [Lycopersicon esculentum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAB78333.1| Score 58 E Value 3e-13 Identity 64.90% Align. Length 300bp (38.02%) Frame 2
SERINE CARBOXYPEPTIDASE I PRECURSOR-like protein [Arabidopsis thaliana] emb|CAB53091.1| SERINE CARBOXYPEPTIDASE I PRECURSOR-like protein [Arabidopsis thaliana] pir||A85139 hypothetical protein AT4g12910 [imported] - Arabidopsis thaliana
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0115F17
Clone
Clone name
hba-115f17
LE_HBa0115F17
P115F17
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found