Clone Read LE_HBa0216E07_SP6_390660

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0216E07_SP6_390660
Primer
SP6
ID from Seq. Facility
LE_HBa_216_E07-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
715 trimmed for vector and quality, 1018 raw
Sequence
>LE_HBa0216E07_SP6_390660 (raw untrimmed)
NNCCGCTAGTGTCCCTATAGATTGCAGTCTTTTTGTTTGTGAACTGATTTACCTTCTAATATGTTGAAAGCCTTCTAATTCTGATCAATCCAGATAATAG
GAGATCATATGCGTGCAGTTGTTTATCTGATATCTGATGGTGTCAACCCATCAAATATTGGTAGAGGGTATGTGGTACGTCGCCTCATTAGAAGGGTTGT
TCGAACAGGCAGGTTACTTGGTGTAAAGGGAGATGGGATGGGTGATCTTCAAGGAGCATTTTTGCCAATTCTTGCCAAAAAGGTGATTGAACTAAGCACC
AATATTGATGCTGATGTGAAGACAAGATCATCCCGCATACTTGAGGAATTGAGAAGGGAGGAGCTTCGTTTTGTCTTGACTCTAGAAAGGGGAGAAAAAC
TTCTTGAGCAGATGCTGGCAGATGCATTATTAAATATTCAGGGAACTGAGACTGCACCCTGTCTGTCGGGCAAGGATGCATTCATATTGTATGACACCTA
TGGATTTCCAGTGGAGATAACAAAGGAAGTTGCTGAAGAACGTGGAATCAGTATAGATATGAATAGCTTTGACATAGAAATGGAGAAGCAAAGACAGCTA
TCTCAGGCTGCACATGATACAGTTAAACTAGCAGTTGAAAATGGTGCAAACCATGCTGAAGATATCCCTGATACTGAGTTTCTTGGTTACAATACTCTCC
ATTCCAAGGCAGTGGTTGAGGGTTTGTTGGTAAATGGTAGTCCTGTAACACAAGTCTCCAAAGGAGGTGAAGTTGGAATTTTGCTGAACAGGACTCCATT
TTATGCCGAGTCGGGAGGCCAAATTGGGGATAACCGGTTTTCTAACATGATGGAAGCTGAAAATGGACAGAAAGCTATTGTTAAAATAAAAGATGTCCAA
AATCTATGGGTAATATATTTGTCATAAAAGGACAATCACGAAAAGTTCTATAAAGGTTGGCCTAAAAAAAAAGCTGCTGTTGATGCAAACTTAGAAACCC
GGCTTAGGTTTTATTTTG
>LE_HBa0216E07_SP6_390660 (trimmed for quality and cloning vector)
AGTCTTTTTGTTTGTGAACTGATTTACCTTCTAATATGTTGAAAGCCTTCTAATTCTGATCAATCCAGATAATAGGAGATCATATGCGTGCAGTTGTTTA
TCTGATATCTGATGGTGTCAACCCATCAAATATTGGTAGAGGGTATGTGGTACGTCGCCTCATTAGAAGGGTTGTTCGAACAGGCAGGTTACTTGGTGTA
AAGGGAGATGGGATGGGTGATCTTCAAGGAGCATTTTTGCCAATTCTTGCCAAAAAGGTGATTGAACTAAGCACCAATATTGATGCTGATGTGAAGACAA
GATCATCCCGCATACTTGAGGAATTGAGAAGGGAGGAGCTTCGTTTTGTCTTGACTCTAGAAAGGGGAGAAAAACTTCTTGAGCAGATGCTGGCAGATGC
ATTATTAAATATTCAGGGAACTGAGACTGCACCCTGTCTGTCGGGCAAGGATGCATTCATATTGTATGACACCTATGGATTTCCAGTGGAGATAACAAAG
GAAGTTGCTGAAGAACGTGGAATCAGTATAGATATGAATAGCTTTGACATAGAAATGGAGAAGCAAAGACAGCTATCTCAGGCTGCACATGATACAGTTA
AACTAGCAGTTGAAAATGGTGCAAACCATGCTGAAGATATCCCTGATACTGAGTTTCTTGGTTACAATACTCTCCATTCCAAGGCAGTGGTTGAGGGTTT
GTTGGTAAATGGTAG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.968356
Expected error %
0.114765
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0216E07
Clone
Clone name
hba-216e7
LE_HBa0216E07
P216E07
Clone type
BAC
Contamination
none
Estimated length
119,702
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found