Clone Read LE_HBa0216E11_T7_390678

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0216E11_T7_390678
Primer
T7
ID from Seq. Facility
LE_HBa_216_E11-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
818 trimmed for vector and quality, 987 raw
Sequence
>LE_HBa0216E11_T7_390678 (raw untrimmed)
NCTATGACGGGGATCTCTGAGTCGACCTGCAGGCATGCAAGCTTTTGCAGCTTACGAACCTCTCAGCAGCACCAAGCTTAACCTAGAGTCCTATATCTTT
TGTCCACGTATACTTATCAGAATACACTATTCAGAACCGAACATTGTCCTCTATAGGTATGTGCTTGTCGTGTTCTCTGCCACAGACCACTACTTTGATT
TTGGTTATCACATTTCATACCTTTAGTCCTGTTAGTATACTATATGGTATAAGTTGCCCATTTTCCTGGATGGCTGTGTACTTCACTAAAAAACAAATAG
GAATTGAATAGACTTGATGGCTCTAATACTGAAACTGATAATGTTCACTCCCTCTGTCCCAATTCAAGCGTCTTAGTTTGATTTGGCATGTAGTTTAAGA
AATGAAATGAGACTTTTAAACCTTGTGATCTTAAATTAAAGATGTGTGTAGTTCTTTAAATCTTGTAGTCTTAAACTTTTCATGTAGATTGTTGGAATTG
GAAAACGTATTAAGTATAGAAAGAAGCCACTCTTTTTTGGACAAAACAAATAGGAAAGTAAAACACTTAAATTGGGACGAAGGGAGTACAGATCAATTAT
ATATTTTATTCCACAAGTTATTTTAGACATTGTCAGAAGCGATGCACTAATGAATTCCTTTCAGGTTTATGTGGATACTGTTGGTGATCCTGAAAAGTAT
AGAGTGAAGCTATCTGAAATTTTTCCAGCAATCAAATTTGTTGTTGCAAAAAAAGCTGACAGTCTTTACCCCGTCGTAAGTGGAGCCAGTATTGTTGCAA
AGGTGACTTGGCATCTGTCACTTTGTCTCGCTCTATTTACCTCTCCCTTTGTAAAATTAGAATCTGAATATTCATAAATCTTAATGTCGTTTTAAACCAT
CCTTCAGGTTACTAGGGACCCACCCTTTCGGGAATGGGGGCTTTATAAAACTGCTGAAAACATCAAAAGGAATTTCCGATCTTGTAT
>LE_HBa0216E11_T7_390678 (trimmed for quality and cloning vector)
CTGCAGGCATGCAAGCTTTTGCAGCTTACGAACCTCTCAGCAGCACCAAGCTTAACCTAGAGTCCTATATCTTTTGTCCACGTATACTTATCAGAATACA
CTATTCAGAACCGAACATTGTCCTCTATAGGTATGTGCTTGTCGTGTTCTCTGCCACAGACCACTACTTTGATTTTGGTTATCACATTTCATACCTTTAG
TCCTGTTAGTATACTATATGGTATAAGTTGCCCATTTTCCTGGATGGCTGTGTACTTCACTAAAAAACAAATAGGAATTGAATAGACTTGATGGCTCTAA
TACTGAAACTGATAATGTTCACTCCCTCTGTCCCAATTCAAGCGTCTTAGTTTGATTTGGCATGTAGTTTAAGAAATGAAATGAGACTTTTAAACCTTGT
GATCTTAAATTAAAGATGTGTGTAGTTCTTTAAATCTTGTAGTCTTAAACTTTTCATGTAGATTGTTGGAATTGGAAAACGTATTAAGTATAGAAAGAAG
CCACTCTTTTTTGGACAAAACAAATAGGAAAGTAAAACACTTAAATTGGGACGAAGGGAGTACAGATCAATTATATATTTTATTCCACAAGTTATTTTAG
ACATTGTCAGAAGCGATGCACTAATGAATTCCTTTCAGGTTTATGTGGATACTGTTGGTGATCCTGAAAAGTATAGAGTGAAGCTATCTGAAATTTTTCC
AGCAATCAAATTTGTTGTTGCAAAAAAAGCTGACAGTCTTTACCCCGTCGTAAGTGGAGCCAGTATTGTTGCAAAGGTGACTTGGCATCTGTCACTTTGT
CTCGCTCTATTTACCTCT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.963651
Expected error %
0.160403
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0216E11
Clone
Clone name
hba-216e11
LE_HBa0216E11
P216E11
Clone type
BAC
Contamination
none
Estimated length
112,112
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found