Clone Read LE_HBa0233H10_SP6_390721

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0233H10_SP6_390721
Primer
SP6
ID from Seq. Facility
LE_HBa_233_H10-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
5 trimmed for vector and quality, 1517 raw
Sequence
>LE_HBa0233H10_SP6_390721 (raw untrimmed)
NTCCCCCCAATCAAAGAGAGGGGGGGCGCCCCNCGGNNNATATATACAAAAAANNAACANACAAAAAAAANNNNNNNNAACCCACATCAAAAAGGGGAGG
GGGCCCCCCCCGCCNCCCNCATCTAGGAGGAGGGACAACACACANAAACCCANACCCCCAGGAGGAGAACAACACCCGACACCAGCCCACCCACCACAAC
CACACGCCCACAAGCAGCAACCGACCGCANCCGCGGAAAGCCAGCCCCCCCACCCAAACGACACCCGAACCAGCACCCCGCCACAGCCCCAACCGGCGGG
GGGCGGGGGGGAGGAAGGACCCAACCGACACCCAAGAACACCACAAGACCGACCCCAGCACGAACAACCGCACACGGGCGGGGGGGGAGCAGACACCAAC
GCACACACGCCAAAGCACACCACACCGCAACACAGCACAGCAAGGGGCACGCACACCCCACACACCCGGACAACCACCCAACCCACGGCAAACAACCACC
GCCAACCACAACCCAAACCAGCACCCCACCACCAACCCAACAAAACGCACAACGCACGACCACGACCCCCCAAACACCCACCGCACCACCCAACGCACAC
AGGCCGCCACAACCCCACACCCACCACACAACCAACACCCGACGCGACCAACCACAGACCACAACCACGACGCAGCCCCACGGCAACGCACAGACCACCC
CCCCCACCCCACCAACCCGACGCGGGGGGGGGGGGGAGGGGCGCANACACAACCAACGACACACCACCCGAACGCCAACAAACCCAACAAACCACACCCC
CCCCACCACAACAAGCCTCACCCAAAAACGCCAACGACACACGCCGCAACACCGCCCAAAAGCAAGCCCCCAACACCCCCAACAACACCAACCGACCCAC
AACACACAACACCCAACACCCCCAACACCACAAACAGGCCCCAACCCCCCCAACGCGCACACACACACCGAACCAACACCCGCGCCCATCACCCCCCCCC
ACCCCGCACACAACCCACCCAACACCCACCCCCCACACCCACACCCCAACACCCACCGCCACCCACGCGCACCAACAACAAACACCCCACCGCACCGCAG
ACCCCCCGACCCCCAAACCCCCCACACACACCACGCACCAAACACGACCAACCACGCACCCCACCACCCACACACACCCGCAACACNCCCCAGCACCACC
AACCAGCCCCGACCACACACCGCAAAACCCCCAAACACACACAACACACGCACCCAAGCCACACGCCCCACACCCCACCACCCCACCGGACCACACCAAC
AAACCACCCACCGCACCAACCACCCACCCACACAGCGCACCCCACACCAAAAACCCACACAACAACCGCAACACCACACCACCCACGACCCAATCACCAC
CAACACCCGCGCCAAAGCCAACACCCCCGAACCGAACCACCACCAAAGCACAACAACCACGCCCGCACACACCACACCCACGCCGACCCACACCCACACG
CCACACGCACACCCGCA
>LE_HBa0233H10_SP6_390721 (trimmed for quality and cloning vector)
AAAAA

This is probably not a useful sequence.

Problems:
  • Short cloning insert
  • Low complexity
Warnings:
  • Not screened for repetitive elements
  • Not screened for contaminants
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
not recorded
Expected error %
0.399909
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0233H10
Clone
Clone name
hba-233h10
LE_HBa0233H10
P233H10
Clone type
BAC
Contamination
none
Estimated length
92,326
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found