Clone Read LE_HBa0115G22_SP6_39114

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0115G22_SP6_39114
Primer
SP6
ID from Seq. Facility
LE_HBa_115_G22-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
726 trimmed for vector and quality, 881 raw
Genbank Accession
Sequence
>LE_HBa0115G22_SP6_39114 (raw untrimmed)
CGGGGGGGATATTCTCTTTCGTATCTGGTGTTATCAAGTTCTCTGAGCGGACATGTGCTCTTCGTTCAGCAAAAATCGAGAATCTCAGGGACTCAATGCT
GACATCCCCTGATCCTGGACCAAATTATGCTAAATTCATGGAGGAATATACTTTGAAGAAAGCTGAGGGCTTCTACGTGATTGCGGATGAGGTTAAAGAA
ATCTCACTTCCAATTGATCATTCTTACCCTACTCGTAAAGATAAATTGCTGCTGATATCTGAAGCTTTCGATCAGTTCCAGACTTTTAAACGTCTTTTTG
TGGATCTCATCCTTAGCTTCCAGGACAGAGACAACAGCCAATTTTACTTCAAGCAACTTACTCCAAAAGATGCTTTTGATGTGATCGAGACAGAGTTAGG
ATTTGCATATGATACCTTCTATACCAAAGCACCCGTTATTTATACTCCTCTAGGCTTCATTCTTCGTGTGATTACTTTCTCTTGCACTTTCTTTACCTTG
ATTTCATTTTCTTTATGTAAGGAAAGATCGAAATACCACATACTTGACTTGATTCTCACTTACCTGCTGCTGGTGGTGGCCTTTCTCCTGGAAATATGTG
CATTGATCGTTTTGCTGTACTCAGACTGGACAAAGAATTGGCTGAGCAAAGGGAAACACGACAGAAAGTTTTGCCAGTCATTCCTCCTCAAAAAGCTGTG
TCTGCGAAGATCAACTAATATGAGGTGGGTCCATGGCACACTGCAATACAATTTGTTGAGCTACTGTGTTGATTTCAGCCCCCCACGGTGCTACTGGTTT
CCAAAACTCTCCCAATCAATGAGCTCTGGGAAAACCCACGTACAGAAGGTTGAATTAGTCTCCCTCAGGTAAAAATGCGAT
>LE_HBa0115G22_SP6_39114 (trimmed for quality and cloning vector)
GGTGTTATCAAGTTCTCTGAGCGGACATGTGCTCTTCGTTCAGCAAAAATCGAGAATCTCAGGGACTCAATGCTGACATCCCCTGATCCTGGACCAAATT
ATGCTAAATTCATGGAGGAATATACTTTGAAGAAAGCTGAGGGCTTCTACGTGATTGCGGATGAGGTTAAAGAAATCTCACTTCCAATTGATCATTCTTA
CCCTACTCGTAAAGATAAATTGCTGCTGATATCTGAAGCTTTCGATCAGTTCCAGACTTTTAAACGTCTTTTTGTGGATCTCATCCTTAGCTTCCAGGAC
AGAGACAACAGCCAATTTTACTTCAAGCAACTTACTCCAAAAGATGCTTTTGATGTGATCGAGACAGAGTTAGGATTTGCATATGATACCTTCTATACCA
AAGCACCCGTTATTTATACTCCTCTAGGCTTCATTCTTCGTGTGATTACTTTCTCTTGCACTTTCTTTACCTTGATTTCATTTTCTTTATGTAAGGAAAG
ATCGAAATACCACATACTTGACTTGATTCTCACTTACCTGCTGCTGGTGGTGGCCTTTCTCCTGGAAATATGTGCATTGATCGTTTTGCTGTACTCAGAC
TGGACAAAGAATTGGCTGAGCAAAGGGAAACACGACAGAAAGTTTTGCCAGTCATTCCTCCTCAAAAAGCTGTGTCTGCGAAGATCAACTAATATGAGGT
GGGTCCATGGCACACTGCAATACAAT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.969228
Expected error %
0.226535
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g45540.1 Score 130 E Value 6e-31 Identity 12.60% Align. Length 635bp (87.47%) Frame 2
68418.m05593 expressed protein contains Pfam domain, PF04578: Protein of unknown function, DUF594; expression supported by MPSS
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g45460.1 Score 127 E Value 6e-30 Identity 12.50% Align. Length 701bp (96.56%) Frame 2
68418.m05585 expressed protein
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_914665.1| Score 137 E Value 3e-31 Identity 12.10% Align. Length 725bp (99.86%) Frame 2
P0431G06.13 [Oryza sativa (japonica cultivar-group)]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAD87859.1| Score 137 E Value 3e-31 Identity 12.10% Align. Length 725bp (99.86%) Frame 2
unknown protein [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0115G22
Clone
Clone name
hba-115g22
LE_HBa0115G22
C12HBa0115G22
P115G22
Clone type
BAC
Contamination
none
Estimated length
118,235
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found