Clone Read LE_HBa0115G22_T7_39115

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0115G22_T7_39115
Primer
T7
ID from Seq. Facility
LE_HBa_115_G22-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
789 trimmed for vector and quality, 866 raw
Genbank Accession
Sequence
>LE_HBa0115G22_T7_39115 (raw untrimmed)
CTTAACCTGGGTCCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGTGTGGAATGCAGTTGAAGGGAAATAGTAAAAGCTACCTATTTGAT
CTTTAACTTGCAAAATGTATGTGAAATTCTTCCCTGGTGGAATTGGACATGTTGTTCCCCATACTCCATCTTCAAATGAGTTTCTCCTATTTTGTATTCC
ATTCCTATAAGTAATTTCGAAACGTATTAAGTAACAGCTCGTGTCTGACTAATTAATATCACAGAATCATAGATGTCGTCACGACAGAATAAGTAGAGAC
TAAATAATAGTATATGGTATTTTTGCATTTTTTGGTATGTCATTGTCTACTCATGCTTAACGAACTAACTTCAAGCCTCGATTCATTCTCTGCGAAAAGG
AATGAGTTGATTCGCGATTTGTGCTCATGAACCAAGGTTTCTTTAAGTGTTTATCGAGAAAAGCTACTTTTTTAGGTTTTATTAAGATAATTTTTGTTAC
TATTCAAAAACACTTATCTTTTTCTAAAAAGTCTGACTTCAATATTCTCTAAAATAATATTATAAACATTGTTAGTGCTATTATTTAAATTCAAAATTAA
ATATTTGTGTAGTGAAAATGTGGACATATTTTGCTTTTTTACTTGTGTTGTTCACATGCACTTCACATGATTACCTACTCTTTGTCTAGTTTTTTTTTCT
TCAAAATATATACACTCGTACAAGTTATATCATGTGACTTGCACAAAATTATAAATAATTCAAAATATTGTTCAACTTTTCCTACATTTGATCAATAAAA
TATTCTTGAATCTTGATTACATCGATATCGATGCTAGTTATATTTCGAAAATAAGTTGGAAAATGC
>LE_HBa0115G22_T7_39115 (trimmed for quality and cloning vector)
AGCTTGTGTGGAATGCAGTTGAAGGGAAATAGTAAAAGCTACCTATTTGATCTTTAACTTGCAAAATGTATGTGAAATTCTTCCCTGGTGGAATTGGACA
TGTTGTTCCCCATACTCCATCTTCAAATGAGTTTCTCCTATTTTGTATTCCATTCCTATAAGTAATTTCGAAACGTATTAAGTAACAGCTCGTGTCTGAC
TAATTAATATCACAGAATCATAGATGTCGTCACGACAGAATAAGTAGAGACTAAATAATAGTATATGGTATTTTTGCATTTTTTGGTATGTCATTGTCTA
CTCATGCTTAACGAACTAACTTCAAGCCTCGATTCATTCTCTGCGAAAAGGAATGAGTTGATTCGCGATTTGTGCTCATGAACCAAGGTTTCTTTAAGTG
TTTATCGAGAAAAGCTACTTTTTTAGGTTTTATTAAGATAATTTTTGTTACTATTCAAAAACACTTATCTTTTTCTAAAAAGTCTGACTTCAATATTCTC
TAAAATAATATTATAAACATTGTTAGTGCTATTATTTAAATTCAAAATTAAATATTTGTGTAGTGAAAATGTGGACATATTTTGCTTTTTTACTTGTGTT
GTTCACATGCACTTCACATGATTACCTACTCTTTGTCTAGTTTTTTTTTCTTCAAAATATATACACTCGTACAAGTTATATCATGTGACTTGCACAAAAT
TATAAATAATTCAAAATATTGTTCAACTTTTCCTACATTTGATCAATAAAATATTCTTGAATCTTGATTACATCGATATCGATGCTAGT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.928163
Expected error %
0.483943
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g76160.1 Score 97 E Value 1e-20 Identity 28.60% Align. Length 146bp (18.50%) Frame 3
68414.m08844 multi-copper oxidase type I family protein similar to pollen-specific BP10 protein [SP|Q00624][Brassica napus]; contains Pfam profile: PF00394 Multicopper oxidase
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g22010.1 Score 96 E Value 3e-20 Identity 27.20% Align. Length 146bp (18.50%) Frame 3
68417.m03185 multi-copper oxidase type I family protein similar to pollen-specific BP10 protein [SP|Q00624][Brassica napus]; contains Pfam profile: PF00394 Multicopper oxidase
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAA65634.1| Score 102 E Value 2e-20 Identity 29.90% Align. Length 146bp (18.50%) Frame 3
PS60 [Nicotiana tabacum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAN15546.1| Score 97 E Value 6e-19 Identity 28.60% Align. Length 146bp (18.50%) Frame 3
pectinesterase, putative [Arabidopsis thaliana] gb|AAM97070.1| pectinesterase, putative [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0115G22
Clone
Clone name
hba-115g22
LE_HBa0115G22
C12HBa0115G22
P115G22
Clone type
BAC
Contamination
none
Estimated length
118,235
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found