Clone Read LE_HBa0233O20_SP6_391443

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0233O20_SP6_391443
Primer
SP6
ID from Seq. Facility
LE_HBa_233_O20-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
747 trimmed for vector and quality, 971 raw
Sequence
>LE_HBa0233O20_SP6_391443 (raw untrimmed)
NNNNCCGCAGCTCTCCCGGCGATATTCTTTTGACGATTTGATAATAACGCTAATGTTCATCATCAAATGCCTGTGAACTATACACAGCCAAGTGAGTAAC
TTTTTCATATCCTGTTGATTTTAATTTGAAATTTCCCTCCTTGTACTTCCTGAGATTCGTCTTACTGAAGCTGCTCCTTGTTTGTGCATCTATGATTACT
TTTATCTTTTTCAATATGATTTCTTTAATTATTTGTGGCCAGCCATTCCTTAATCATTTTATTTTGACAAAATGTTTGGTAAGAGGAGACCTTAAAAAAA
TGAGGAGACCTTAAAGACTGGAATAACTTGAGAGAGGATTAGATTATAATTCATAAAGCAAGCCTCCATGTGGATACATACATACACTAGGCAGAGAGGG
GTAAGGCTGCATAGGCGCCACCTTTCCCAGATCTCACTTGTGGGATCACACTGGATATGTTGTTGTATATATATATATACAATACACCGACACAAAAATA
TTTCTTGTTATTTCTTTGCTCTAAGTTATGGGCAAAGTTTAATATGGTTGAGAGAGTAGATACTGAACATGTTCACTTTTCTCTTGAGTTTTTTTTCCAG
GAAAAATAAAGTGTCCTAGCATGTCATATATTGTCTGATAAATAGTATTGTATCTTTTTGTGTACTTTGTACAAGTGATAGTGTGTAGTGCATCTAATGC
TTGAAGCAGGGAAATATTGGTGTCACAGTTGTTTTGAACTGACTTCTGAAGGTGCATTGGTATTGTGACAGGTCGACATAATGTTTATTCAAATGAATAC
CAGACTCCTCTGAGGACGAAGACATTTTCAGCCATGGTCACAAAAAGTTTTCCAAAATGGCTATACCGTTGGAAACTGTTATTTGATGGAAACCCCCTTC
GTGGATTAATAATTTCCCTCCAAACCAAAACCTGAACAAACCTCCCTGGTATGGATCCTATCAGGGGCATG
>LE_HBa0233O20_SP6_391443 (trimmed for quality and cloning vector)
ATTCTTTTGACGATTTGATAATAACGCTAATGTTCATCATCAAATGCCTGTGAACTATACACAGCCAAGTGAGTAACTTTTTCATATCCTGTTGATTTTA
ATTTGAAATTTCCCTCCTTGTACTTCCTGAGATTCGTCTTACTGAAGCTGCTCCTTGTTTGTGCATCTATGATTACTTTTATCTTTTTCAATATGATTTC
TTTAATTATTTGTGGCCAGCCATTCCTTAATCATTTTATTTTGACAAAATGTTTGGTAAGAGGAGACCTTAAAAAAATGAGGAGACCTTAAAGACTGGAA
TAACTTGAGAGAGGATTAGATTATAATTCATAAAGCAAGCCTCCATGTGGATACATACATACACTAGGCAGAGAGGGGTAAGGCTGCATAGGCGCCACCT
TTCCCAGATCTCACTTGTGGGATCACACTGGATATGTTGTTGTATATATATATATACAATACACCGACACAAAAATATTTCTTGTTATTTCTTTGCTCTA
AGTTATGGGCAAAGTTTAATATGGTTGAGAGAGTAGATACTGAACATGTTCACTTTTCTCTTGAGTTTTTTTTCCAGGAAAAATAAAGTGTCCTAGCATG
TCATATATTGTCTGATAAATAGTATTGTATCTTTTTGTGTACTTTGTACAAGTGATAGTGTGTAGTGCATCTAATGCTTGAAGCAGGGAAATATTGGTGT
CACAGTTGTTTTGAACTGACTTCTGAAGGTGCATTGGTATTGTGACA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.952296
Expected error %
0.246202
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0233O20
Clone
Clone name
hba-233o20
LE_HBa0233O20
C03HBa0233O20
P233O20
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found