Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

Clone Read LE_HBa0233P14_SP6_391515

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0233P14_SP6_391515
Primer
SP6
ID from Seq. Facility
LE_HBa_233_P14-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
296 trimmed for vector and quality, 904 raw
Sequence
>LE_HBa0233P14_SP6_391515 (raw untrimmed)
NGCTGTGAGCGTACTCTTTCTGGGGATTTCCGATTGTTTTACCTTTTGGACCCTATAGCTTGCTTGCGACTTGGGAAATCCTACTGGCCAGAATCATTGT
TCTAGGAGCAATAGTCGTATTTGTAAAGGCTAAGCATACTTGTGAGGGTTATCATGTTTTACTTCTATATTTTTGAGATATTAGAAATTAAAGAACTTAT
TTGATTGCATTTTTAAGGCTGTATATGCTCAGTGAACTAGTTGAGGACTTTCATACCTTGGTTGGTCTACCG
TTTGAACTCTTGAACGGGTGTTGGACTA
TTTCTTGTCTAAAAGACTGAGATTTTGTGAGGAAACTTGTACTTGTATTATTTTTACTTGCTGGGATATCTGACAGATTATCTCGGTACCTTGATTACCT
CTTGTCACTTTGCATTGTCGTGTTGTTGTCATTTGTGACGTTGAACAATCTTTGTAACTCACTCACTTGTATGAATTGCTTCTTCACTAGGCACTCTTGT
TGGGATCTTGTCCTTCTTGTGGATATGCCTTTTTCACTATTGTCATGCCTCTTAATTTGGATCATTTTCTACCTTGACTCTAGATTTTTACTTCGTCTTA
CGCATGACAGTTGTCCACTTAGACTACAAACTAGAAAGCTCTTTTTAATATGGTTATTGCTTCTCTCAATTATGGGGATCTAAACCTTCATGATACAAGG
GATCTACCCTTCTTGATATCTGTTCGACCTTGATGTGACCATATGGTGTGTATGATGCGCGAAGACTTTATCTTGCACCTCTTGGAAAAAGGTGGTATGA
ACCTTCTCGAATGCTTGAGCTTTTCGTTTGCAACCTCGACGCTTTTTGGATAATGGTGACTTGCACGACTGTTTTGTCGCTTCAATTAACCGGCCCTTCC
CTTG
>LE_HBa0233P14_SP6_391515 (trimmed for quality and cloning vector)
TTTGAACTCTTGAACGGGTGTTGGACTATTTCTTGTCTAAAAGACTGAGATTTTGTGAGGAAACTTGTACTTGTATTATTTTTACTTGCTGGGATATCTG
ACAGATTATCTCGGTACCTTGATTACCTCTTGTCACTTTGCATTGTCGTGTTGTTGTCATTTGTGACGTTGAACAATCTTTGTAACTCACTCACTTGTAT
GAATTGCTTCTTCACTAGGCACTCTTGTTGGGATCTTGTCCTTCTTGTGGATATGCCTTTTTCACTATTGTCATGCCTCTTAATTTGGATCATTTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.915827
Expected error %
1.92078
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0233P14
Clone
Clone name
hba-233p14
LE_HBa0233P14
P233P14
Clone type
BAC
Contamination
none
Estimated length
62,217
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found