Clone Read LE_HBa0115H22_T7_39163

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0115H22_T7_39163
Primer
T7
ID from Seq. Facility
LE_HBa_115_H22-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
784 trimmed for vector and quality, 869 raw
Genbank Accession
Sequence
>LE_HBa0115H22_T7_39163 (raw untrimmed)
CGAAAACTGGGTCCCGGGGGGTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTGTTATTGATCAACAAAGCAACTAATTACAAATAGATTGTTCATGT
AATCAAACAACAAACAGCAAAATACAAAATAGCTAATGAAAAGAAAATGACATAACTCTTAGCATAAGCCCTATGATTGTTTTCCCCATTTGTCACTGAG
CACAAAGACATGCCACAACACAGCAGTGAAGAGACAAACAACATGTCACCAAAACATAACATCACTTGCGTTCTGCAGTGAAGATGAGCCATAACAAAAC
TTAACGATCCTCAAATCTGAGTCAGTAGTTATCAAAATCCATTCGATTCCATACTCTATTGATAAAGGTAACCTCCTTACGTTTGCAGATGATACAATTC
TGGTGATCTTCTTTCTATTGCTATGATGATTAAGAAGTTGGATACCTATGAGCAAGTTTCTGGTCAAATGGTTACTAACAAAAAATCCACTTTTTTGATC
TCTGCTAATATTCCTGCCCCCACTCCTTCTTCCCTATTAATTATCTGGAATGCCCTATTTATTGGGGAAGAAAGAAAATTATCTACTTTAGTAGTATGGT
CTCCAAAATCGTCAATGTTACTCAAGGATGGTTGGGTAATTTGCTCTCTATGGGTGGCGAAGTTCTTCTTATTAGATCAGTGTTGCACTCGATGCCCCTT
ACATATCATCTCTTTGGCTCACTTATTGAAAAATCTCTTGCTAACTTCTTTTGGGGGTCCTCGGAAGGAATGATTGTGAACAAAAATATTCTTTGAAAGG
TGGCATGGAAATCTTTCTTTTTGTTGGGATATTGGAATTACAGAGGGGCTCTTGCTACTTGGGTGGACA
>LE_HBa0115H22_T7_39163 (trimmed for quality and cloning vector)
AGCTTTGTTATTGATCAACAAAGCAACTAATTACAAATAGATTGTTCATGTAATCAAACAACAAACAGCAAAATACAAAATAGCTAATGAAAAGAAAATG
ACATAACTCTTAGCATAAGCCCTATGATTGTTTTCCCCATTTGTCACTGAGCACAAAGACATGCCACAACACAGCAGTGAAGAGACAAACAACATGTCAC
CAAAACATAACATCACTTGCGTTCTGCAGTGAAGATGAGCCATAACAAAACTTAACGATCCTCAAATCTGAGTCAGTAGTTATCAAAATCCATTCGATTC
CATACTCTATTGATAAAGGTAACCTCCTTACGTTTGCAGATGATACAATTCTGGTGATCTTCTTTCTATTGCTATGATGATTAAGAAGTTGGATACCTAT
GAGCAAGTTTCTGGTCAAATGGTTACTAACAAAAAATCCACTTTTTTGATCTCTGCTAATATTCCTGCCCCCACTCCTTCTTCCCTATTAATTATCTGGA
ATGCCCTATTTATTGGGGAAGAAAGAAAATTATCTACTTTAGTAGTATGGTCTCCAAAATCGTCAATGTTACTCAAGGATGGTTGGGTAATTTGCTCTCT
ATGGGTGGCGAAGTTCTTCTTATTAGATCAGTGTTGCACTCGATGCCCCTTACATATCATCTCTTTGGCTCACTTATTGAAAAATCTCTTGCTAACTTCT
TTTGGGGGTCCTCGGAAGGAATGATTGTGAACAAAAATATTCTTTGAAAGGTGGCATGGAAATCTTTCTTTTTGTTGGGATATT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.96119
Expected error %
0.77774
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38805.1| Score 72 E Value 2e-14 Identity 48.80% Align. Length 367bp (46.81%) Frame 3
hypothetical protein PGEC747E24.5 [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0115H22
Clone
Clone name
hba-115h22
LE_HBa0115H22
P115H22
Clone type
BAC
Contamination
none
Estimated length
115,230
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found