Clone Read LE_HBa0234E08_T7_391997

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0234E08_T7_391997
Primer
T7
ID from Seq. Facility
LE_HBa_234_E08-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
140 trimmed for vector and quality, 1009 raw
Sequence
>LE_HBa0234E08_T7_391997 (raw untrimmed)
AGCCCTAGGGCGACCTGCAGGCATGCAAGGCTTTGAACTATCCATCTTCAATGATCGTGGTGAATCTCCTTAGCTCTAATACCAGTTGTTAGGATCGAAT
TGACGCACACACACTTGATGAATGAAGAACACAAGAACTTTCAAGAGAAAGAGATGAGAGATGTGGAGAGAGAAAGAGAAAACCCAATATTTCGTGGTGA
CACCCCGCGATTAAACTTCCACGGCGGTGGGGTATATTTAGATTAATAAATCAGCTATATATATATGTTAATCAGGCTCCACAACCTAATAGAAACATCC
TTTCTTTTTACCTTAACAAATCGTTATTTTAAAGTTAGATATAAAATATATCAAAAATATATTTTAAGCCGCAATCGAAAACATGTTATGCAAATGTCGA
ACTACAACATTATTTAAAAATATTAAAGAAATTTCAAGAGAAAGAAATTAAGTAAATGCTGTTGAAATATCCCAGAATCTAGTCCTTTCGTTTAATTGAC
TTGTACCACCAACGTCAGGACCCCGTCCATATAATTTAATATAAAGTGAAGATATACTGATTGAAGAGAAAGGTACCAGTACCGTTTTTCTAAATACTCC
TGTGACCCCCAAATTTGGCATAGCCTACTTTACCGTCATTACTAGGGTTCACCTACATATCGAAATGTCCGGACCAGAGGGGCAATACTCTTTTGAGTTA
CGGGGCCGTTAATATTCCTAGGGTGCGGTGGAATATGGGGCTAATGAGAAAAGTCTCCATGTGGAATGGGCGTTTTTCTAATGCCAATGCAAACCCATTG
GGAACCCAAGACATGGGAGCAGTATGAAGCAAATCCGCTGGGATTCTCGCCGGAACCAATATGCTGGTGATGGTTTCGCCCCGGGCTTTTCGCCCGCAAG
GGAGGAAAGAATTTTTAGAGAAATGTTGTTCACGATATTCGAAGAAGTGATAATTTGGGGTCCCTCCAAGTATCTATAACGATGTTGCTGGATCTATAAA
CGCACTGGG
>LE_HBa0234E08_T7_391997 (trimmed for quality and cloning vector)
GATCGAATTGACGCACACACACTTGATGAATGAAGAACACAAGAACTTTCAAGAGAAAGAGATGAGAGATGTGGAGAGAGAAAGAGAAAACCCAATATTT
CGTGGTGACACCCCGCGATTAAACTTCCACGGCGGTGGGG

This is probably not a useful sequence.

Problems:
  • Short cloning insert
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.891506
Expected error %
2.06055
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0234E08
Clone
Clone name
hba-234e8
LE_HBa0234E08
P234E08
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found