Clone Read LE_HBa0234E22_SP6_392053

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0234E22_SP6_392053
Primer
SP6
ID from Seq. Facility
LE_HBa_234_E22-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
632 trimmed for vector and quality, 1001 raw
Sequence
>LE_HBa0234E22_SP6_392053 (raw untrimmed)
CCCACGCTGTCTATNNNNNNNNTNNNNANTNNNNGCNANTNTNTCCCTATANAAAGAAAAAAATTTACTACCTTACTTAAGCAATTATCAGATCAATCTT
TGAAGTCACCCTATTCCCTTTCATTTTAGTTTACAAGTCTCTAGTAGACCTACTTCGTATTGACAAGGAACAATCATCTTAAGCCAATCATGTCATGGAA
AGCAACCATAGCAACTACCCAAGCTAAACTACATATCATAGGGGGTCATATCATAGGTATCTTCGAGTCATACTTGTGCAATGCATGGATAGCATCCCAT
ACTACCATCCACACTAAGTACTTCTCTAGACCAACCTAATCCAAGCTAACTAATGAAGGAAACACCCATCATAACCATCATGCAACAAATCATGTAAATG
CAAACTAATCATAGGGGAGCATGAATCCTCAACCCTAAGCTATCATGAGAAAGTACTCTCAAGCTATTTCATGAAATGCACTTTGCATACAAGTCAAGCT
ATCATTAGGAGAGTATAGTCTTTTCCCCTCAAGCTATCATGAATTGGTTTAGGCCTAACCAAATCAAGCTATTATGAAGGAACTCTAGTCATGCTACTTC
AAGATAATATTAGGAGAGCTACAGTAGTCAATGCCAAGCTATCATGAGAACCACCATTCCCAAAATAACATTATCAAGCATTTTAGTAACACATGACCTA
GCTAAACATGAAAGAACTTACTTCCATTATCCCAAGCTATCATGAAGATTCCATCACTTAAATCTATCAGGAGGCCTAACATTTCCAGGCAACACACATT
GGGCCTTATCTTACCAAGTCCACTAAATCAAAAAAAAGGTTTTTCCATACAATTTCCAAGTTGGTTATAAGTCCATCCAGGGCCTGGAATCCATTTTTAG
GGTTTTAAGGTTCAACCAAACCATTCCTTCTTTTGTGGAAAAAAACTTGGGTTCCCCCTACCTTGGTCCACTCTCTTAAGGGGAAAAAAAAACAAAAAAA
A
>LE_HBa0234E22_SP6_392053 (trimmed for quality and cloning vector)
AAAGAAAAAAATTTACTACCTTACTTAAGCAATTATCAGATCAATCTTTGAAGTCACCCTATTCCCTTTCATTTTAGTTTACAAGTCTCTAGTAGACCTA
CTTCGTATTGACAAGGAACAATCATCTTAAGCCAATCATGTCATGGAAAGCAACCATAGCAACTACCCAAGCTAAACTACATATCATAGGGGGTCATATC
ATAGGTATCTTCGAGTCATACTTGTGCAATGCATGGATAGCATCCCATACTACCATCCACACTAAGTACTTCTCTAGACCAACCTAATCCAAGCTAACTA
ATGAAGGAAACACCCATCATAACCATCATGCAACAAATCATGTAAATGCAAACTAATCATAGGGGAGCATGAATCCTCAACCCTAAGCTATCATGAGAAA
GTACTCTCAAGCTATTTCATGAAATGCACTTTGCATACAAGTCAAGCTATCATTAGGAGAGTATAGTCTTTTCCCCTCAAGCTATCATGAATTGGTTTAG
GCCTAACCAAATCAAGCTATTATGAAGGAACTCTAGTCATGCTACTTCAAGATAATATTAGGAGAGCTACAGTAGTCAATGCCAAGCTATCATGAGAACC
ACCATTCCCAAAATAACATTATCAAGCATTTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.943447
Expected error %
0.261964
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0234E22
Clone
Clone name
hba-234e22
LE_HBa0234E22
C02HBa0234E22
P234E22
Clone type
BAC
Contamination
none
Estimated length
38,840
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found