Clone Read LE_HBa0234K09_SP6_392588

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0234K09_SP6_392588
Primer
SP6
ID from Seq. Facility
LE_HBa_234_K09-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
608 trimmed for vector and quality, 988 raw
Sequence
>LE_HBa0234K09_SP6_392588 (raw untrimmed)
GCCCGGAGTATCCGTCCTTGCTGTCAGAAGGATATAACTGCGTCTTATATGATGATGGATCCAGTCTCAACATATTCCCATTATCGACTTTGAGGCAGTT
AAAGTTTGACTTGGGAAAGATTCAACAAAACCATGTCAATATAAGGTCACTCGATTGGGTACAAAGAGACACACTAGGGCAGTAAATTTGATCATTTAGA
TGGTTCCTGCAGAAGTCAACATGGAGTTTTAGGTTTTGGACATTAACACTAGCTACAACCTTCTTTTGGAAAGGTCGTTCATCCTATGATTGGAGTGGGN
NNNNNTGCCTTCTACCCTTCATCAACTACTGAAATTTGCTTGGAAGGATCAAATTGTTTATGGGAGGAAGAATCAGGNNNNNNNNNTGGGTATGCATCGA
TCATTGATGAAGTCTCTCGAGGGAGTGATTTCTACGAGATGGAGCTGGTAAATGCCACCGATGAAAATTTGGCCCCTAAGCCCTCAATGCCTGCCGTATA
CAAAATTATGCCTACTGTGATGCTTCAGAATGGATTTGAGCTATGTTTCGGATTATGAAGGAATTTCCAAGGAATTGTCGAGCCTATCAAAGTTCCCAAC
AAAGGAGCAAAGTTTGGTTTGGGGTACATCCGCACAACTGATGANNNAAAAAAAAAAAAATTAAATAAANNNNNNNAATTGGCTAGTCCAATTCCTCATT
TGTACTTGTCATTTCAAGTTTGAGAGTATGCTGATCATAATGCCCTTGGGAAAAGAGTCTGGGCCTTTTTGAAGAAAATGATGTTGTCCTAGAGGACAAG
GAACAGACCTCCCANNNNNNGCCCTGGGGGAGAAAAAAAAAAACCCCCCCCCCCTTCCAAAAAGGGGGGAGTTNTAANNNNNNTNNNNNNNNTNNNNNNC
NANAGGAGACANNNNNNNTTTTGAAAAACCGGGGGAAATCCCGGAAAAAGCCCTGAAACCCCCCAATTTTGCCATTTCCCTTGAATGN
>LE_HBa0234K09_SP6_392588 (trimmed for quality and cloning vector)
AACTGCGTCTTATATGATGATGGATCCAGTCTCAACATATTCCCATTATCGACTTTGAGGCAGTTAAAGTTTGACTTGGGAAAGATTCAACAAAACCATG
TCAATATAAGGTCACTCGATTGGGTACAAAGAGACACACTAGGGCAGTAAATTTGATCATTTAGATGGTTCCTGCAGAAGTCAACATGGAGTTTTAGGTT
TTGGACATTAACACTAGCTACAACCTTCTTTTGGAAAGGTCGTTCATCCTATGATTGGAGTGGGNNNNNNTGCCTTCTACCCTTCATCAACTACTGAAAT
TTGCTTGGAAGGATCAAATTGTTTATGGGAGGAAGAATCAGGNNNNNNNNNTGGGTATGCATCGATCATTGATGAAGTCTCTCGAGGGAGTGATTTCTAC
GAGATGGAGCTGGTAAATGCCACCGATGAAAATTTGGCCCCTAAGCCCTCAATGCCTGCCGTATACAAAATTATGCCTACTGTGATGCTTCAGAATGGAT
TTGAGCTATGTTTCGGATTATGAAGGAATTTCCAAGGAATTGTCGAGCCTATCAAAGTTCCCAACAAAGGAGCAAAGTTTGGTTTGGGGTACATCCGCAC
AACTGATG

This is probably not a useful sequence.

Problems:
  • High predicted error rate
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
  • Not screened for contaminants
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.990722
Expected error %
3.63051
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0234K09
Clone
Clone name
hba-234k9
LE_HBa0234K09
C08HBa0234K09
P234K09
Clone type
BAC
Contamination
none
Estimated length
43,866
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found