Clone Read LE_HBa0234L07_T7_392686

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0234L07_T7_392686
Primer
T7
ID from Seq. Facility
LE_HBa_234_L07-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
431 trimmed for vector and quality, 980 raw
Sequence
>LE_HBa0234L07_T7_392686 (raw untrimmed)
GGTATCTAAGTCGACCTGCAGGCATGCAAGCTTCAAATATATAGAGGCTTACTTCTTTGTGGCTTCTTGTTTTTATTTGGTTAAAAGATCTTTCTTAGGA
AGAGGAATGGATTTGATTTCACTCAAAATGGTGAATGATTCTTTGAAACTCCAAAGACATCTTCGAGGTTGGCAACAAATTTAACAGTGGGAATATGGGT
AGCACAATATTGAAAATGCTTGAAATAGAAGGCGATTCCAAATTAGGAAAAGTTTGAGGAAATCAGAAGTAGGTTCATTGAAAAACCCTTTAACGGCAAT
TACAAACCAAATGCTTATTGTGATTAACTTAACGATATTCCCTATGATTCTTGTCAAACTTGAGTAATTAACGATCCCAGTTTGCCTAACACTTCTTCTG
GATTTAAGAGAGAATTGTACCGGATGAAATATAACTCTAAAATGGATTCTTATTATTTCACTCCTACGTGGAAGAAACTTCGATCCTTCATAGTACTTGG
TACTTTTTTTCAACAAATTCCCCACTTCCAATAAATAAAATTAATCAATTTTCATCTTCACTAGCCCACCATTTATTGACGATACTATACCCGCCACCGC
TCTTCTTGCCTACCCCTAACATTAAGGTGTAAATAGAAACACTTTCATGTCAATTCTAACTATTCTTCAATGATGAATGTCACCAGTTGAGGGATTCTCC
TTCCACCGTCCATGTTGAAAGTTGTTAAATAGAACTATCAGTGGGTATCACAACCATCGAATCATCTCTGGGCCTGAAATACCTCAACTATAAATCCTCT
GGTTTTCTCAAAAACCGAAATCCTTGTTAAAGATATATTCCCTGTTTTCACTTTGTATCGTCGGTCTTCAAGACTTAATATGACCCTGAATTCCTTATAA
TAGTGCCTCTTCTCTAAGGACATATTATTCTTAAGCCGACCACACTCGCTTTATCCGTCTATCTCACCCAACCCTTGCTC
>LE_HBa0234L07_T7_392686 (trimmed for quality and cloning vector)
AATATATAGAGGCTTACTTCTTTGTGGCTTCTTGTTTTTATTTGGTTAAAAGATCTTTCTTAGGAAGAGGAATGGATTTGATTTCACTCAAAATGGTGAA
TGATTCTTTGAAACTCCAAAGACATCTTCGAGGTTGGCAACAAATTTAACAGTGGGAATATGGGTAGCACAATATTGAAAATGCTTGAAATAGAAGGCGA
TTCCAAATTAGGAAAAGTTTGAGGAAATCAGAAGTAGGTTCATTGAAAAACCCTTTAACGGCAATTACAAACCAAATGCTTATTGTGATTAACTTAACGA
TATTCCCTATGATTCTTGTCAAACTTGAGTAATTAACGATCCCAGTTTGCCTAACACTTCTTCTGGATTTAAGAGAGAATTGTACCGGATGAAATATAAC
TCTAAAATGGATTCTTATTATTTCACTCCTA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.933609
Expected error %
1.03501
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0234L07
Clone
Clone name
hba-234l7
LE_HBa0234L07
P234L07
Clone type
BAC
Contamination
none
Estimated length
135,339
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found