Clone Read LE_HBa0217E12_T7_392915

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0217E12_T7_392915
Primer
T7
ID from Seq. Facility
LE_HBa_217_E12-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
122 trimmed for vector and quality, 958 raw
Sequence
>LE_HBa0217E12_T7_392915 (raw untrimmed)
NNNCCGACCGTCGGGGACTCTGAGTCGACCTGCAGCATGCAGCTTGCAACCAGGTTTACTTGGACGTTTATCTGCTTTCCACCATGAGGATGTTAAAGCA
TTGACTCTGCATAATCAGAAATTCCTTCAACTTAACAAGGACATTGACAAGCGTGAGTATTCTATAGTGTCACCTAAATAGCTTGGCGTAATCATGGTCA
TAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACAAGCCGAGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGC
TAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGAACCCCTTGCGG
CCGCCCGGGCCGTCAACCAATTCTCATGTTTGACAGCTTATCATCTAATTTCTGCCAGTCATCCGCTTATCATCACTTACTCAGGCGTAGCAACCAGACG
TTTAAGGGCACCAATAACTGCCCTAAAAAAATTACGCCCCGCCCTGCCACTCATCACAGTACTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCC
ATCACAAACGGCATGATGAACCTGAATCGCCTGCGGCATCAGCACCTTGTCGCCTTGCGTATAATATTTGCCCATGGTGAAAACCGGGGCGAAGAAGTTG
TCCATATTGGCCACGTTTAAATCAAAACTGGTGAAACTCTACCAGGGGATTGGCTGAGACCAAAAACATATTCCCAATAAACCCTTTAGGGAAAAAGCCC
AGTTTTCAACGGAACCCGTCCAATCTTTGCAATAAATGTGTAAAAACTGCCGGAAAACCTTCTGGTATTCCCCCCAAACCATGAAAAATTTCCATTTTGC
TCATGGAAACAGTGTAACAGGGTTAACATATTCCCTATTCCCACCTCCCCCTCTTTCG
>LE_HBa0217E12_T7_392915 (trimmed for quality and cloning vector)
ACCTGCAGCATGCAGCTTGCAACCAGGTTTACTTGGACGTTTATCTGCTTTCCACCATGAGGATGTTAAAGCATTGACTCTGCATAATCAGAAATTCCTT
CAACTTAACAAGGACATTGACA

This is probably not a useful sequence.

Problems:
  • Short cloning insert
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, short insert
Quality trim threshold
14.5
Sequence entropy
0.929786
Expected error %
3.20322
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0217E12
Clone
Clone name
hba-217e12
LE_HBa0217E12
C12HBa0217E12
P217E12
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found