Clone Read LE_HBa0115L10_T7_39331

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0115L10_T7_39331
Primer
T7
ID from Seq. Facility
LE_HBa_115_L10-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
663 trimmed for vector and quality, 894 raw
Genbank Accession
Sequence
>LE_HBa0115L10_T7_39331 (raw untrimmed)
TATAACTGGGTCCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTATATAACTTCCTATGCTTTGAAACTAAAAACTACAAAAAAGAAGTAA
CTTTTATCAACTTTATGAACAATACACACACATTCAAAAGGAAACCAGCAACTTAAAATTCAGGGATGAATTTATATGCTTATTACAGGGCAGGTAAACC
TGTAGTTTCTTCGTAAAATTAAATGGTGCACTTGATTGATAATGTTGAGTTATTTATCTAGATGAGTCAGGGATCAATTTCCACTTAATACATTTTCTTC
ATTTTCATTGTTACACTCATATTCTAAAAATTCTTAATTCGTATGATACATGCACTTATTTTAAAGAGATTGTAAGTTCATCGAAAAAATGAAACAAAAT
GATAAAATGAAGAAAAATAACCAAATTATAATGGAAAAAGATTTAAAGCTTACCAAGGATGAAGAATTGCCTTTTTCTCTTCGGAATTTCGTCAAACACC
TTATTCCCTATTTGTAAATTTTTATGAGTTTTACCCAAATCTAGGGCATGGGGTTTGTAAAGAGAGAAAAATTGGGAAAATACTTTATAGTATGTTATTG
GATCGGATTTGAGTCTCGTTTATAAGTGAAAAAATGATAGACCTAAGGTAAAAAAGTTACTTATTTAAAACAGGAGAATATTTTATTAACCTTATATATA
TATATATATATATAAATACACACTGAACACAATAACATACATGAGTAGCAGCACTAGGAAGCGACCCGCATCCACTGCTTACCGACATTAATATCGCCCT
CCTCCGACAACCCGGCTCCTCATCTAAAAGGATAAAACTAGTAACCACAGTGTTACACTCCTATTATCCCTCCCCATCATCTACCACCATAATC
>LE_HBa0115L10_T7_39331 (trimmed for quality and cloning vector)
AGCTTATATAACTTCCTATGCTTTGAAACTAAAAACTACAAAAAAGAAGTAACTTTTATCAACTTTATGAACAATACACACACATTCAAAAGGAAACCAG
CAACTTAAAATTCAGGGATGAATTTATATGCTTATTACAGGGCAGGTAAACCTGTAGTTTCTTCGTAAAATTAAATGGTGCACTTGATTGATAATGTTGA
GTTATTTATCTAGATGAGTCAGGGATCAATTTCCACTTAATACATTTTCTTCATTTTCATTGTTACACTCATATTCTAAAAATTCTTAATTCGTATGATA
CATGCACTTATTTTAAAGAGATTGTAAGTTCATCGAAAAAATGAAACAAAATGATAAAATGAAGAAAAATAACCAAATTATAATGGAAAAAGATTTAAAG
CTTACCAAGGATGAAGAATTGCCTTTTTCTCTTCGGAATTTCGTCAAACACCTTATTCCCTATTTGTAAATTTTTATGAGTTTTACCCAAATCTAGGGCA
TGGGGTTTGTAAAGAGAGAAAAATTGGGAAAATACTTTATAGTATGTTATTGGATCGGATTTGAGTCTCGTTTATAAGTGAAAAAATGATAGACCTAAGG
TAAAAAAGTTACTTATTTAAAACAGGAGAATATTTTATTAACCTTATATATATATATATATAT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.90313
Expected error %
0.288122
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0115L10
Clone
Clone name
hba-115l10
LE_HBa0115L10
C03HBa0115L10
P115L10
Clone type
BAC
Contamination
none
Estimated length
82,977
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found