Clone Read LE_HBa0235B23_T7_393362

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0235B23_T7_393362
Primer
T7
ID from Seq. Facility
LE_HBa_235_B23-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
562 trimmed for vector and quality, 817 raw
Sequence
>LE_HBa0235B23_T7_393362 (raw untrimmed)
TCATGTCGGGGTCTCTGAGTCACTGCAGGCATGCAGCTTTATGCAAGTTTTCAAGTGCGCATTTTTGGCTTAGTTCGGTAGCATTCTTGGGACATGGAGC
GTCTAAGGAGGGTATCATGGTGGATTCTAAGAAGATTGAGGCGGTTAGAGATTGGGTCAGACCTACTTCAGTTACTGAGATTCGGAGTTTCTTGGGCCTT
GCAGGTTATTATCGACGGTTTGTTGAGGGTTTCTCATCCATTGCATCTCCATTAACTAGATTGACACAGAAGGAGGTGACTTTTCAGTGGTCTGACGAAT
GTGAGGTTAGTTTCCAAAAGCTCAAGACTTTATTGACTACTGCTCCGATTTTGACCCTACCCGTGGAGGGAGAGGGTTTTGTCGTATATTGTGATGCTTC
TCGGGTTGGTCTTGGTTGTGTGTTGATGCGGAGTGGAAGGGTGATAGCTTATGCTTCGAGGCAGTTAAAGGTTCATGAGAAGAACTACCCTATTCATGAT
TTAGAATTGGCGGCTGTGGTGTTTGCATTAAAGATTTGGAGGCATTATCTTTATGGTGTGCATTGTGAGGTGTTCACGGATCATCATAGTCTCCAGTATA
TATTCAATCAGAGGGATCTAAGTTTTGATGCATAGGATATGGGTTGAGTTTGTTCAAAGACTACCTATTTGACTTGTTCTTTATTCCCCAGAGCCAAGTA
ATTGGTTGTATTTTATGCCTTTGAGTTTGTGCGGGCGTTACCTCAGGGTTAGATGTTCCTTTGTTTTCCGGTTGGGCTATGTTTCCCCCTTACATTGGTG
ATCTTTTATTTCTCTGT
>LE_HBa0235B23_T7_393362 (trimmed for quality and cloning vector)
CTGCAGGCATGCAGCTTTATGCAAGTTTTCAAGTGCGCATTTTTGGCTTAGTTCGGTAGCATTCTTGGGACATGGAGCGTCTAAGGAGGGTATCATGGTG
GATTCTAAGAAGATTGAGGCGGTTAGAGATTGGGTCAGACCTACTTCAGTTACTGAGATTCGGAGTTTCTTGGGCCTTGCAGGTTATTATCGACGGTTTG
TTGAGGGTTTCTCATCCATTGCATCTCCATTAACTAGATTGACACAGAAGGAGGTGACTTTTCAGTGGTCTGACGAATGTGAGGTTAGTTTCCAAAAGCT
CAAGACTTTATTGACTACTGCTCCGATTTTGACCCTACCCGTGGAGGGAGAGGGTTTTGTCGTATATTGTGATGCTTCTCGGGTTGGTCTTGGTTGTGTG
TTGATGCGGAGTGGAAGGGTGATAGCTTATGCTTCGAGGCAGTTAAAGGTTCATGAGAAGAACTACCCTATTCATGATTTAGAATTGGCGGCTGTGGTGT
TTGCATTAAAGATTTGGAGGCATTATCTTTATGGTGTGCATTGTGAGGTGTTCACGGATCAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.959392
Expected error %
0.667009
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0235B23
Clone
Clone name
hba-235b23
LE_HBa0235B23
P235B23
Clone type
BAC
Contamination
none
Estimated length
145,099
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found