Clone Read LE_HBa0218C03_SP6_394184

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0218C03_SP6_394184
Primer
SP6
ID from Seq. Facility
LE_HBa_218_C03-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
776 trimmed for vector and quality, 878 raw
Sequence
>LE_HBa0218C03_SP6_394184 (raw untrimmed)
NNCCGTATGACCCCAATATCAAGATTTTGCCTTATAAGTCTTTTACTATCATCACCATTACCATTACTATTCACTCTCCCCCCACCCCACAATGCCTCAG
TGGGTTTTTGTTATGCCTCGTCCTCAAATTTGGAACCACCAGTATGTCAAGGGTTCGCTCGAACTCCTTTCATGAACCTCTTTTGATATAAAATCTTATT
ATTTATATATGACTAAAATTATTTTTTATGTATATATAATAAATATTGAATCTCTTCAATTAATTTATATATTTACTTTGTTTAAATTTTAAACATCGTT
ATTAAAAATTCTAATTCTACCACTACTCGTCCTGATGCTTATTCCGCCTTTGAAAACTCATCCAATCTTGTTGACTATCATAACAATAGCACCTACCATG
GTCTCTAAAGTCTTGTTTAGCACCTATAATTGACCATAAGCCCTCACCAGTGCGAATAATCTACATCTAAAATGATAAGTTTGTGTATGATGCATATTAT
ATCACTTGAAATTAGCATAATTATTTATTTAATTTTATATAAATTTTAATATTTAATTATACATTTTTAAAATAATACGAATATAACGATACAACTAAAA
GTTAAAAAGCACATTTATATCCAGAAAATAAAGCAAACGCATAACAAAAGAGCATGAACACTAACCTCTTCCCGGAATATAAATGATCCCTTCTCCGGCA
CGGAATTTTGCATCCATATCTGAATTATACCTTCGTATTAACTCAGCGCTCACATTCATTGTCGCCGTCACATACGTCAAATTCTCCTCCGATCTCNAAG
GATACGTTACAAAAAGCCCAAAATCTTCAGATACATCTCTATCTCCACAAGACAATTCACTTCAACACTCAAATTCCC
>LE_HBa0218C03_SP6_394184 (trimmed for quality and cloning vector)
ATCAAGATTTTGCCTTATAAGTCTTTTACTATCATCACCATTACCATTACTATTCACTCTCCCCCCACCCCACAATGCCTCAGTGGGTTTTTGTTATGCC
TCGTCCTCAAATTTGGAACCACCAGTATGTCAAGGGTTCGCTCGAACTCCTTTCATGAACCTCTTTTGATATAAAATCTTATTATTTATATATGACTAAA
ATTATTTTTTATGTATATATAATAAATATTGAATCTCTTCAATTAATTTATATATTTACTTTGTTTAAATTTTAAACATCGTTATTAAAAATTCTAATTC
TACCACTACTCGTCCTGATGCTTATTCCGCCTTTGAAAACTCATCCAATCTTGTTGACTATCATAACAATAGCACCTACCATGGTCTCTAAAGTCTTGTT
TAGCACCTATAATTGACCATAAGCCCTCACCAGTGCGAATAATCTACATCTAAAATGATAAGTTTGTGTATGATGCATATTATATCACTTGAAATTAGCA
TAATTATTTATTTAATTTTATATAAATTTTAATATTTAATTATACATTTTTAAAATAATACGAATATAACGATACAACTAAAAGTTAAAAAGCACATTTA
TATCCAGAAAATAAAGCAAACGCATAACAAAAGAGCATGAACACTAACCTCTTCCCGGAATATAAATGATCCCTTCTCCGGCACGGAATTTTGCATCCAT
ATCTGAATTATACCTTCGTATTAACTCAGCGCTCACATTCATTGTCGCCGTCACATACGTCAAATTCTCCTCCGAT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.92986
Expected error %
0.0630431
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0218C03
Clone
Clone name
hba-218c3
LE_HBa0218C03
P218C03
Clone type
BAC
Contamination
none
Estimated length
75,797
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found